Rmu_co8425251.1_g000001

Alba

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8425251.1
Physical Location & Seq
Reverse (-)
495 .. 1234
740 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8425251.1_g000001.1.cds

Sequence Viewer

Length: 363 bp
atgggtagagctatcaacaagactaggagggttgccggccttcatcaaaacacctatattggctctactgatataactgacatgtgggagccactagaagaaggtcttcttcccctggaaactactcgccatgtttcagtgattacagttactttgtccaagaaggaattggacacgtcctctacagggtatcagggacctatcccagctgatcaagtgaaaccatggactgaatatgattatgaaggacgtaaggccacaagttatgatctcactattagggacctcctagtatgcgaggaagaggacgtggtcgaggaaggggtagacgaagaggtaatagacgacggtttaagatcttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

120

Amino Acids

13.5

Weight (kDa)

4.39

Isoelectric Point (pI)

40.8

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 327
AfiI CCNNNNNNNGG 1 cut(s) 186
AflIII ACRYGT 2 cut(s) 81, 174
AjiI CACGTC 2 cut(s) 177, 310
AjnI CCWGG 1 cut(s) 114
AluBI AGCT 2 cut(s) 11, 209
AluI AGCT 2 cut(s) 11, 209
AoxI GGCC 2 cut(s) 37, 255
Asp700I GAANNNNTTC 1 cut(s) 105
AspS9I GGNCC 2 cut(s) 197, 283
AvaII GGWCC 2 cut(s) 197, 283
BbsI GAAGAC 1 cut(s) 98
BciT130I CCWGG 1 cut(s) 116
BclI TGATCA 1 cut(s) 211
BfaI CTAG 3 cut(s) 24, 95, 290
BfmI CTRYAG 1 cut(s) 183
BglII AGATCT 1 cut(s) 356
Bme1390I CCNGG 1 cut(s) 116
Bme18I GGWCC 2 cut(s) 197, 283
BmgBI CACGTC 2 cut(s) 177, 310
BmgT120I GGNCC 2 cut(s) 197, 283
BmiI GGNNCC 3 cut(s) 90, 198, 284
BmrFI CCNGG 1 cut(s) 116
BpiI GAAGAC 1 cut(s) 98
BsaJI CCNNGG 2 cut(s) 114, 224
Bsc4I CCNNNNNNNGG 1 cut(s) 186
Bse118I RCCGGY 1 cut(s) 35
BseBI CCWGG 1 cut(s) 116
BseDI CCNNGG 2 cut(s) 114, 224
BseLI CCNNNNNNNGG 1 cut(s) 186
BseYI CCCAGC 1 cut(s) 205
BshFI GGCC 2 cut(s) 39, 257
BsiSI CCGG 1 cut(s) 36
BslFI GGGAC 2 cut(s) 210, 296
BslI CCNNNNNNNGG 1 cut(s) 186
BsmFI GGGAC 2 cut(s) 210, 296
BsnI GGCC 2 cut(s) 39, 257
Bsp143I GATC 3 cut(s) 211, 268, 356
Bsp19I CCATGG 1 cut(s) 224
BspANI GGCC 2 cut(s) 39, 257
BspLI GGNNCC 3 cut(s) 90, 198, 284
BsrFI RCCGGY 1 cut(s) 35
BssAI RCCGGY 1 cut(s) 35
BssECI CCNNGG 2 cut(s) 114, 224
BssMI GATC 3 cut(s) 211, 268, 356
BssT1I CCWWGG 1 cut(s) 224
Bst2UI CCWGG 1 cut(s) 116
Bst4CI ACNGT 2 cut(s) 148, 350
Bst6I CTCTTC 2 cut(s) 297, 327
BstC8I GCNNGC 1 cut(s) 37
BstDSI CCRYGG 1 cut(s) 224
BstKTI GATC 3 cut(s) 214, 271, 359
BstMBI GATC 3 cut(s) 211, 268, 356
BstNI CCWGG 1 cut(s) 116
BstNSI RCATGY 1 cut(s) 85
BstSCI CCNGG 1 cut(s) 114
BstSFI CTRYAG 1 cut(s) 183
BstV2I GAAGAC 1 cut(s) 98
BstX2I RGATCY 1 cut(s) 356
BstYI RGATCY 1 cut(s) 356
BsuRI GGCC 2 cut(s) 39, 257
BtgI CCRYGG 1 cut(s) 224
BtrI CACGTC 2 cut(s) 177, 310
BtsIMutI CAGTG 1 cut(s) 144
Cac8I GCNNGC 1 cut(s) 37
Cfr10I RCCGGY 1 cut(s) 35
Cfr13I GGNCC 2 cut(s) 197, 283
CviAII CATG 3 cut(s) 82, 131, 225
CviJI RGCY 6 cut(s) 11, 39, 63, 91, 209, 257
CviKI_1 RGCY 6 cut(s) 11, 39, 63, 91, 209, 257
DpnI GATC 3 cut(s) 213, 270, 358
DpnII GATC 3 cut(s) 211, 268, 356
Eam1104I CTCTTC 2 cut(s) 297, 327
EarI CTCTTC 2 cut(s) 297, 327
Eco130I CCWWGG 1 cut(s) 224
Eco47I GGWCC 2 cut(s) 197, 283
EcoO109I RGGNCCY 2 cut(s) 197, 283
EcoRII CCWGG 1 cut(s) 114
EcoT14I CCWWGG 1 cut(s) 224
ErhI CCWWGG 1 cut(s) 224
FaeI CATG 3 cut(s) 85, 134, 228
FaiI YATR 9 cut(s) 57, 74, 83, 132, 226, 237, 243, 267, 295
FalI AAGNNNNNCTT 4 cut(s) 90, 122, 93, 125
FaqI GGGAC 2 cut(s) 210, 296
FatI CATG 3 cut(s) 81, 130, 224
FbaI TGATCA 1 cut(s) 211
FblI GTMKAC 1 cut(s) 327
FspBI CTAG 3 cut(s) 24, 95, 290
GsaI CCCAGC 1 cut(s) 209
HaeIII GGCC 2 cut(s) 39, 257
HapII CCGG 1 cut(s) 36
Hin1II CATG 3 cut(s) 85, 134, 228
HpaII CCGG 1 cut(s) 36
Hpy166II GTNNAC 1 cut(s) 328
Hpy188III TCNNGA 1 cut(s) 360
Hpy8I GTNNAC 1 cut(s) 328
Hpy99I CGWCG 1 cut(s) 350
HpyAV CCTTC 5 cut(s) 50, 95, 157, 239, 314
HpyCH4III ACNGT 2 cut(s) 148, 350
HpyCH4IV ACGT 3 cut(s) 176, 250, 309
HpySE526I ACGT 3 cut(s) 176, 250, 309
Hsp92II CATG 3 cut(s) 85, 134, 228
KroI GCCGGC 1 cut(s) 35
KroNI GCCGGC 1 cut(s) 37
Ksp22I TGATCA 1 cut(s) 211
Kzo9I GATC 3 cut(s) 211, 268, 356
LmnI GCTCC 1 cut(s) 88
LpnPI CCDG 6 cut(s) 49, 101, 128, 171, 179, 219
MaeI CTAG 3 cut(s) 24, 95, 290
MaeII ACGT 3 cut(s) 176, 250, 309
MaeIII GTNAC 1 cut(s) 148
MalI GATC 3 cut(s) 213, 270, 358
MboI GATC 3 cut(s) 211, 268, 356
MboII GAAGA 5 cut(s) 98, 101, 110, 314, 344
MflI RGATCY 1 cut(s) 356
MluCI AATT 1 cut(s) 167
MnlI CCTC 7 cut(s) 21, 190, 292, 296, 298, 310, 328
MroNI GCCGGC 1 cut(s) 35
MroXI GAANNNNTTC 1 cut(s) 105
MseI TTAA 1 cut(s) 353
MspA1I CMGCKG 1 cut(s) 209
MspI CCGG 1 cut(s) 36
MspR9I CCNGG 1 cut(s) 116
MvaI CCWGG 1 cut(s) 116
NaeI GCCGGC 1 cut(s) 37
NcoI CCATGG 1 cut(s) 224
NdeII GATC 3 cut(s) 211, 268, 356
NgoMIV GCCGGC 1 cut(s) 35
NlaIII CATG 3 cut(s) 85, 134, 228
NlaIV GGNNCC 3 cut(s) 90, 198, 284
NspI RCATGY 1 cut(s) 85
PciI ACATGT 1 cut(s) 81
PdiI GCCGGC 1 cut(s) 37
PdmI GAANNNNTTC 1 cut(s) 105
PflFI GACNNNGTC 1 cut(s) 311
PpuMI RGGWCCY 2 cut(s) 197, 283
PscI ACATGT 1 cut(s) 81
Psp5II RGGWCCY 2 cut(s) 197, 283
Psp6I CCWGG 1 cut(s) 114
PspFI CCCAGC 1 cut(s) 205
PspGI CCWGG 1 cut(s) 114
PspN4I GGNNCC 3 cut(s) 90, 198, 284
PspPI GGNCC 2 cut(s) 197, 283
PspPPI RGGWCCY 2 cut(s) 197, 283
PsuI RGATCY 1 cut(s) 356
PsyI GACNNNGTC 1 cut(s) 311
PvuII CAGCTG 1 cut(s) 209
SaqAI TTAA 1 cut(s) 353
Sau3AI GATC 3 cut(s) 211, 268, 356
Sau96I GGNCC 2 cut(s) 197, 283
ScrFI CCNGG 1 cut(s) 116
SfcI CTRYAG 1 cut(s) 183
SinI GGWCC 2 cut(s) 197, 283
Sse9I AATT 1 cut(s) 167
SspMI CTAG 3 cut(s) 24, 95, 290
StyD4I CCNGG 1 cut(s) 114
StyI CCWWGG 1 cut(s) 224
TaaI ACNGT 2 cut(s) 148, 350
TaiI ACGT 3 cut(s) 179, 253, 312
TaqI TCGA 1 cut(s) 315
TasI AATT 1 cut(s) 167
Tru1I TTAA 1 cut(s) 353
Tru9I TTAA 1 cut(s) 353
TscAI CASTG 1 cut(s) 144
TspDTI ATGAA 2 cut(s) 32, 258
TspRI CASTG 1 cut(s) 144
Tth111I GACNNNGTC 1 cut(s) 311
VpaK11BI GGWCC 2 cut(s) 197, 283
XceI RCATGY 1 cut(s) 85
XcmI CCANNNNNNNNNTGG 1 cut(s) 166
XmiI GTMKAC 1 cut(s) 327
XmnI GAANNNNTTC 1 cut(s) 105
XspI CTAG 3 cut(s) 24, 95, 290
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.