Rorug02G0225200

Ribonuclease P protein subunit

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000002
Physical Location & Seq
Forward (+)
21988335 .. 21989316
982 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug02G0225200.1

Sequence Viewer

Length: 522 bp
ATGGACCAGCAAGGAATTTGCAACAATAAAGATCGTTCAATCTTGGAGTCGAACGAGGCCAGCGAAACTTGGCTGGTAAGCTTTAATGATCATGATCGTCTTAAGGGATTACAAGGCAAAAACAGGAGATTTTCTGGGGCCAGTGTTTCCGAAGAAGAGCTGAAGATTCGCAATGAGCTTGAAATGGAAGTAGAAAAAGACTTGGAGGAAGAAATCAAAGATGGGATATGCCATCTTGCTCTGAGATTGCACAGGCTTTATCAGCACCAAAAGGAGAGAAGTGCAAGCAAATTAGCATTTTGTGAGGTGAATATAAACATACAAATGGAAGGAGGAACCAAGATTGAAATAAAAGAGACCAAAAGGCCAGCACCAGCTGAAAGGGAAAAGAGTTTTCCTCCTCGACCTAGTTCTAGATCATCAACTGTGAGATCAGTTATGAAAGTGGGTGCAACAAACACAAAGAAGTTTGATTGGGCCAAAAGTCTGAGATCGAGTGGTGGTCAAGGATGGAAAGTTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

173

Amino Acids

19.75

Weight (kDa)

8.97

Isoelectric Point (pI)

63.04

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 15
AcuI CTGAAG 1 cut(s) 182
AflII CTTAAG 1 cut(s) 101
AgsI TTSAA 3 cut(s) 39, 182, 347
AluBI AGCT 4 cut(s) 81, 160, 178, 377
AluI AGCT 4 cut(s) 81, 160, 178, 377
Alw26I GTCTC 1 cut(s) 350
AoxI GGCC 4 cut(s) 57, 138, 365, 477
ApoI RAATTY 1 cut(s) 15
AspS9I GGNCC 3 cut(s) 4, 138, 477
AsuHPI GGTGA 1 cut(s) 319
AvaII GGWCC 1 cut(s) 4
BccI CCATC 3 cut(s) 215, 240, 504
BclI TGATCA 1 cut(s) 88
BcoDI GTCTC 1 cut(s) 350
BfaI CTAG 2 cut(s) 408, 414
BfrI CTTAAG 1 cut(s) 101
Bme18I GGWCC 1 cut(s) 4
BmgT120I GGNCC 3 cut(s) 4, 138, 477
BmiI GGNNCC 2 cut(s) 139, 337
BplI GAGNNNNNCTC 2 cut(s) 382, 414
BsaBI GATNNNNATC 1 cut(s) 93
BsaI GGTCTC 1 cut(s) 350
Bse1I ACTGG 1 cut(s) 141
Bse3DI GCAATG 1 cut(s) 178
Bse8I GATNNNNATC 1 cut(s) 93
BseGI GGATG 1 cut(s) 515
BseJI GATNNNNATC 1 cut(s) 93
BseMI GCAATG 1 cut(s) 178
BseMII CTCAG 2 cut(s) 233, 479
BseNI ACTGG 1 cut(s) 141
BseRI GAGGAG 1 cut(s) 390
BshFI GGCC 4 cut(s) 59, 140, 367, 479
BsmAI GTCTC 1 cut(s) 350
BsnI GGCC 4 cut(s) 59, 140, 367, 479
Bso31I GGTCTC 1 cut(s) 350
Bsp143I GATC 6 cut(s) 31, 88, 94, 416, 431, 491
BspANI GGCC 4 cut(s) 59, 140, 367, 479
BspCNI CTCAG 2 cut(s) 234, 480
BspHI TCATGA 1 cut(s) 91
BspLI GGNNCC 2 cut(s) 139, 337
BspQI GCTCTTC 1 cut(s) 150
BspTI CTTAAG 1 cut(s) 101
BspTNI GGTCTC 1 cut(s) 350
BsrDI GCAATG 1 cut(s) 178
BsrI ACTGG 1 cut(s) 141
BssMI GATC 6 cut(s) 31, 88, 94, 416, 431, 491
Bst4CI ACNGT 1 cut(s) 427
Bst6I CTCTTC 1 cut(s) 150
BstAFI CTTAAG 1 cut(s) 101
BstC8I GCNNGC 3 cut(s) 61, 286, 369
BstDEI CTNAG 2 cut(s) 242, 488
BstF5I GGATG 1 cut(s) 515
BstKTI GATC 6 cut(s) 34, 91, 97, 419, 434, 494
BstMAI GTCTC 1 cut(s) 350
BstMBI GATC 6 cut(s) 31, 88, 94, 416, 431, 491
BstMWI GCNNNNNNNGC 1 cut(s) 262
BsuRI GGCC 4 cut(s) 59, 140, 367, 479
BtsCI GGATG 1 cut(s) 515
BtsIMutI CAGTG 1 cut(s) 148
Cac8I GCNNGC 3 cut(s) 61, 286, 369
CciI TCATGA 1 cut(s) 91
Cfr13I GGNCC 3 cut(s) 4, 138, 477
CviAII CATG 1 cut(s) 92
DdeI CTNAG 2 cut(s) 242, 488
DpnI GATC 6 cut(s) 33, 90, 96, 418, 433, 493
DpnII GATC 6 cut(s) 31, 88, 94, 416, 431, 491
Eam1104I CTCTTC 1 cut(s) 150
EarI CTCTTC 1 cut(s) 150
Eco31I GGTCTC 1 cut(s) 350
Eco47I GGWCC 1 cut(s) 4
Eco57I CTGAAG 1 cut(s) 182
FaeI CATG 1 cut(s) 95
FaiI YATR 5 cut(s) 93, 229, 314, 320, 440
FatI CATG 1 cut(s) 91
FbaI TGATCA 1 cut(s) 88
FspBI CTAG 2 cut(s) 408, 414
HaeIII GGCC 4 cut(s) 59, 140, 367, 479
Hin1II CATG 1 cut(s) 95
HindIII AAGCTT 1 cut(s) 79
HinfI GANTC 2 cut(s) 47, 166
HphI GGTGA 1 cut(s) 319
Hpy188I TCNGA 3 cut(s) 151, 243, 489
Hpy188III TCNNGA 2 cut(s) 92, 414
HpyAV CCTTC 1 cut(s) 323
HpyCH4III ACNGT 1 cut(s) 427
HpyCH4V TGCA 4 cut(s) 21, 250, 284, 452
HpyF10VI GCNNNNNNNGC 1 cut(s) 262
HpyF3I CTNAG 2 cut(s) 242, 488
Hsp92II CATG 1 cut(s) 95
Ksp22I TGATCA 1 cut(s) 88
Kzo9I GATC 6 cut(s) 31, 88, 94, 416, 431, 491
LguI GCTCTTC 1 cut(s) 150
LpnPI CCDG 9 cut(s) 20, 59, 73, 109, 120, 154, 238, 381, 387
MaeI CTAG 2 cut(s) 408, 414
MalI GATC 6 cut(s) 33, 90, 96, 418, 433, 493
MboI GATC 6 cut(s) 31, 88, 94, 416, 431, 491
MboII GAAGA 4 cut(s) 164, 167, 175, 221
MluCI AATT 2 cut(s) 15, 290
MlyI GAGTC 1 cut(s) 56
MnlI CCTC 6 cut(s) 49, 199, 298, 326, 408, 411
MseI TTAA 3 cut(s) 84, 102, 520
MslI CAYNNNNRTG 1 cut(s) 323
MspA1I CMGCKG 1 cut(s) 377
MspCI CTTAAG 1 cut(s) 101
MwoI GCNNNNNNNGC 1 cut(s) 262
NdeII GATC 6 cut(s) 31, 88, 94, 416, 431, 491
NlaIII CATG 1 cut(s) 95
NlaIV GGNNCC 2 cut(s) 139, 337
PagI TCATGA 1 cut(s) 91
PciSI GCTCTTC 1 cut(s) 150
PcsI WCGNNNNNNNCGW 1 cut(s) 60
PfeI GAWTC 1 cut(s) 166
PleI GAGTC 1 cut(s) 55
PpsI GAGTC 1 cut(s) 55
PspN4I GGNNCC 2 cut(s) 139, 337
PspPI GGNCC 3 cut(s) 4, 138, 477
PvuII CAGCTG 1 cut(s) 377
RseI CAYNNNNRTG 1 cut(s) 323
SapI GCTCTTC 1 cut(s) 150
SaqAI TTAA 3 cut(s) 84, 102, 520
Sau3AI GATC 6 cut(s) 31, 88, 94, 416, 431, 491
Sau96I GGNCC 3 cut(s) 4, 138, 477
SchI GAGTC 1 cut(s) 56
SetI ASST 6 cut(s) 83, 162, 180, 309, 379, 409
SinI GGWCC 1 cut(s) 4
SmiMI CAYNNNNRTG 1 cut(s) 323
SmlI CTYRAG 1 cut(s) 101
SmoI CTYRAG 1 cut(s) 101
Sse9I AATT 2 cut(s) 15, 290
SspMI CTAG 2 cut(s) 408, 414
TaaI ACNGT 1 cut(s) 427
TaqI TCGA 3 cut(s) 50, 403, 494
TasI AATT 2 cut(s) 15, 290
TfiI GAWTC 1 cut(s) 166
Tru1I TTAA 3 cut(s) 84, 102, 520
Tru9I TTAA 3 cut(s) 84, 102, 520
TscAI CASTG 1 cut(s) 148
TspDTI ATGAA 1 cut(s) 455
TspRI CASTG 1 cut(s) 148
Vha464I CTTAAG 1 cut(s) 101
VpaK11BI GGWCC 1 cut(s) 4
XapI RAATTY 1 cut(s) 15
XbaI TCTAGA 1 cut(s) 413
XspI CTAG 2 cut(s) 408, 414
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.