RLG00000002142

No apical meristem-associated C-terminal domain

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr1
Physical Location & Seq
Forward (+)
26159769 .. 26162364
2596 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000002142

Sequence Viewer

Length: 648 bp
ATGAATAATTCTCAAATATCATCATCCTCTTTGTCTTCAGATGGAGCTGATGATTATTATTATCAGGTCATGGCTTCATTTGATGAGGAGCAAGATTTATTGCTTTGCATGTATGCGAATAATAATAACCTCTTGGCGGAGTTGGATGACAATGAGGACAACGAGGCCAAATCGAGGAGTACAGGAGCAGTTCCTGGCCACATAGATTCTATCGAAGGTGTTAATCAAAAGGAAGATAAAGTATGGGAAAGGATAATTGATTTGTGGAATAAGGATAAGGATGAACACCAGATGCAAAGCGCCAAGTCTCTTCAAAGTAGATTTTCTGATCTTAACTATTGCGTGGAAAATCAGAATCAAAGTGGTGCTTCAAAGAAAGATATTTATGCTAAGGCAAAACAACATCTACTAGATGATCCTAACTATACAAAGAAGAAGCTTCAATTTGATCATGTGTGGCATATTCTCAAGGATGCTAAAAAATGGACCGATAATGATGAAGACGAACAAGAGCTGTTTAGTGATGAACTTGCCTCAACCCATCGGCCTATTGGTGTAAAGAAAGCAAAGTTGAAAAGGAAAGAGTGCGAACACCAAGATTGCTCAACAAGTGAAAGAATCCAACCAAGAACTGAAGGAGTTACTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

216

Amino Acids

24.75

Weight (kDa)

4.91

Isoelectric Point (pI)

54.88

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 137
AclWI GGATC 1 cut(s) 410
AcoI YGGCCR 1 cut(s) 196
AcuI CTGAAG 1 cut(s) 21
AfaI GTAC 1 cut(s) 181
AfiI CCNNNNNNNGG 2 cut(s) 136, 174
AgsI TTSAA 4 cut(s) 314, 372, 443, 574
AjnI CCWGG 1 cut(s) 193
AluBI AGCT 3 cut(s) 47, 439, 514
AluI AGCT 3 cut(s) 47, 439, 514
Alw26I GTCTC 1 cut(s) 312
AlwI GGATC 1 cut(s) 410
AlwNI CAGNNNCTG 1 cut(s) 194
AoxI GGCC 3 cut(s) 165, 196, 545
AspLEI GCGC 1 cut(s) 302
AspS9I GGNCC 1 cut(s) 486
AvaII GGWCC 1 cut(s) 486
BalI TGGCCA 1 cut(s) 198
BbsI GAAGAC 2 cut(s) 27, 507
BccI CCATC 2 cut(s) 35, 549
BciT130I CCWGG 1 cut(s) 195
BclI TGATCA 1 cut(s) 448
BcoDI GTCTC 1 cut(s) 312
BfaI CTAG 1 cut(s) 410
BfoI RGCGCY 1 cut(s) 303
Bme1390I CCNGG 1 cut(s) 195
Bme18I GGWCC 1 cut(s) 486
BmgT120I GGNCC 1 cut(s) 486
BmrFI CCNGG 1 cut(s) 195
BmsI GCATC 2 cut(s) 282, 463
BpiI GAAGAC 2 cut(s) 27, 507
Bpu10I CCTNAGC 1 cut(s) 390
BpuEI CTTGAG 1 cut(s) 452
Bsc4I CCNNNNNNNGG 2 cut(s) 136, 174
BseBI CCWGG 1 cut(s) 195
BseGI GGATG 4 cut(s) 23, 151, 286, 478
BseLI CCNNNNNNNGG 2 cut(s) 136, 174
BseRI GAGGAG 2 cut(s) 101, 190
BshFI GGCC 3 cut(s) 167, 198, 547
BslI CCNNNNNNNGG 2 cut(s) 136, 174
BsmAI GTCTC 1 cut(s) 312
BsnI GGCC 3 cut(s) 167, 198, 547
Bsp143I GATC 3 cut(s) 328, 415, 448
BspACI CCGC 1 cut(s) 137
BspANI GGCC 3 cut(s) 167, 198, 547
BspPI GGATC 1 cut(s) 410
BssMI GATC 3 cut(s) 328, 415, 448
Bst2UI CCWGG 1 cut(s) 195
Bst6I CTCTTC 1 cut(s) 315
BstDEI CTNAG 1 cut(s) 390
BstF5I GGATG 4 cut(s) 23, 151, 286, 478
BstH2I RGCGCY 1 cut(s) 303
BstHHI GCGC 1 cut(s) 302
BstKTI GATC 3 cut(s) 331, 418, 451
BstMAI GTCTC 1 cut(s) 312
BstMBI GATC 3 cut(s) 328, 415, 448
BstNI CCWGG 1 cut(s) 195
BstNSI RCATGY 1 cut(s) 112
BstSCI CCNGG 1 cut(s) 193
BstV2I GAAGAC 2 cut(s) 27, 507
BsuRI GGCC 3 cut(s) 167, 198, 547
BtsCI GGATG 4 cut(s) 23, 151, 286, 478
CaiI CAGNNNCTG 1 cut(s) 194
CfoI GCGC 1 cut(s) 302
Cfr13I GGNCC 1 cut(s) 486
Csp6I GTAC 1 cut(s) 180
CviAII CATG 3 cut(s) 70, 109, 452
CviJI RGCY 7 cut(s) 47, 74, 167, 198, 439, 514, 547
CviKI_1 RGCY 7 cut(s) 47, 74, 167, 198, 439, 514, 547
CviQI GTAC 1 cut(s) 180
DdeI CTNAG 1 cut(s) 390
DpnI GATC 3 cut(s) 330, 417, 450
DpnII GATC 3 cut(s) 328, 415, 448
EaeI YGGCCR 1 cut(s) 196
Eam1104I CTCTTC 1 cut(s) 315
EarI CTCTTC 1 cut(s) 315
EciI GGCGGA 1 cut(s) 152
Eco47I GGWCC 1 cut(s) 486
Eco57I CTGAAG 1 cut(s) 21
EcoRII CCWGG 1 cut(s) 193
FaeI CATG 3 cut(s) 73, 112, 455
FaiI YATR 9 cut(s) 71, 110, 114, 203, 244, 387, 426, 453, 462
FalI AAGNNNNNCTT 2 cut(s) 352, 384
FatI CATG 3 cut(s) 69, 108, 451
FbaI TGATCA 1 cut(s) 448
FokI GGATG 4 cut(s) 10, 158, 293, 485
FspBI CTAG 1 cut(s) 410
GlaI GCGC 1 cut(s) 301
HaeII RGCGCY 1 cut(s) 303
HaeIII GGCC 3 cut(s) 167, 198, 547
HhaI GCGC 1 cut(s) 302
Hin1II CATG 3 cut(s) 73, 112, 455
Hin6I GCGC 1 cut(s) 300
HinP1I GCGC 1 cut(s) 300
HindIII AAGCTT 1 cut(s) 437
HinfI GANTC 3 cut(s) 206, 355, 618
Hpy188I TCNGA 3 cut(s) 40, 328, 354
HpyAV CCTTC 2 cut(s) 209, 629
HpyCH4V TGCA 2 cut(s) 108, 295
HpyF3I CTNAG 1 cut(s) 390
Hsp92II CATG 3 cut(s) 73, 112, 455
HspAI GCGC 1 cut(s) 300
Ksp22I TGATCA 1 cut(s) 448
Kzo9I GATC 3 cut(s) 328, 415, 448
LmnI GCTCC 3 cut(s) 44, 88, 185
LpnPI CCDG 5 cut(s) 50, 168, 180, 207, 302
LweI GCATC 2 cut(s) 282, 463
MaeI CTAG 1 cut(s) 410
MaeIII GTNAC 1 cut(s) 640
MalI GATC 3 cut(s) 330, 417, 450
MboI GATC 3 cut(s) 328, 415, 448
MboII GAAGA 5 cut(s) 27, 245, 302, 445, 512
MlsI TGGCCA 1 cut(s) 198
MluCI AATT 3 cut(s) 7, 255, 443
MluNI TGGCCA 1 cut(s) 198
MmeI TCCRAC 2 cut(s) 123, 646
MnlI CCTC 7 cut(s) 37, 79, 140, 148, 157, 168, 544
Mox20I TGGCCA 1 cut(s) 198
MscI TGGCCA 1 cut(s) 198
MseI TTAA 2 cut(s) 222, 333
Msp20I TGGCCA 1 cut(s) 198
MspR9I CCNGG 1 cut(s) 195
MvaI CCWGG 1 cut(s) 195
NdeII GATC 3 cut(s) 328, 415, 448
NlaIII CATG 3 cut(s) 73, 112, 455
NspI RCATGY 1 cut(s) 112
PfeI GAWTC 3 cut(s) 206, 355, 618
Psp6I CCWGG 1 cut(s) 193
PspGI CCWGG 1 cut(s) 193
PspPI GGNCC 1 cut(s) 486
PstNI CAGNNNCTG 1 cut(s) 194
RsaI GTAC 1 cut(s) 181
RsaNI GTAC 1 cut(s) 180
SaqAI TTAA 2 cut(s) 222, 333
Sau3AI GATC 3 cut(s) 328, 415, 448
Sau96I GGNCC 1 cut(s) 486
ScrFI CCNGG 1 cut(s) 195
SetI ASST 6 cut(s) 49, 69, 132, 220, 441, 516
SfaNI GCATC 2 cut(s) 282, 463
SinI GGWCC 1 cut(s) 486
SmlI CTYRAG 1 cut(s) 467
SmoI CTYRAG 1 cut(s) 467
Sse9I AATT 3 cut(s) 7, 255, 443
SsiI CCGC 1 cut(s) 137
SspMI CTAG 1 cut(s) 410
StyD4I CCNGG 1 cut(s) 193
TaqI TCGA 2 cut(s) 173, 213
TaqII GACCGA 1 cut(s) 503
TasI AATT 3 cut(s) 7, 255, 443
TatI WGTACW 1 cut(s) 179
TfiI GAWTC 3 cut(s) 206, 355, 618
Tru1I TTAA 2 cut(s) 222, 333
Tru9I TTAA 2 cut(s) 222, 333
TspDTI ATGAA 5 cut(s) 17, 66, 297, 513, 540
VpaK11BI GGWCC 1 cut(s) 486
XceI RCATGY 1 cut(s) 112
XcmI CCANNNNNNNNNTGG 1 cut(s) 548
XspI CTAG 1 cut(s) 410
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.