Rw4G006390

No apical meristem-associated C-terminal domain

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr4
OG0003288
Physical Location & Seq
Forward (+)
13212390 .. 13213333
944 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw4G006390.1

Sequence Viewer

Length: 819 bp
ATGGTAGATGTTAGGCATAAGAAAGTTGTCCATCGAAAAGGAAATTTTACTGTCCAAGAAGATCAACTCCTGTGTCATTTATATCTTTCAATTTCTCAGGATTCTATCGAAGGTGTTAATCAAAAGAAAGATAAAGTATGGGAAAGAATAACTGATTTGTGGAATAAGGATAAGGATGAACACCAGATGCGAAGCGTCAAGTCTCTTCAAAGTCGATTTTCTGATCTTAACTATTGCGTAAGCAAATTTCGTGGTTCACTTCGCCAGGTGGAAAATCGGAATCAAAGTGGTGCTTCAGAGAAAGATATTTATGCCCAGGCAAAACAACATCTACTAGATGATCCTAACTATACAAAGAAGAAGTTTCAATTAGATCATGTGTGGCCTATTCTCAAGGATGCTGAAAAATGGACCAATAATGGTAGAAGTTCAACTAAACCACGACAAAAAAATTACTCAAGTGAAGGATATGAATCAACGTCTCGCACATCACAATCGTCAGGTACATTACCATTTGATGTCAATTTGAATGCAGATGAAGACGAACAAGAGCTGTTTAGTGATGAACTTGCCTCACCTCACCGGCCTATTGGTGTAAAGAAAATTGCTCAACAAGTGAAAGAATCCAACCAAGAACTGAAGGAGTTACTTGAAAAAAACTTGTTGGAGAGAAATGATTTTTCCTCTAAGCATGAGGAATATGCATCTCAAAAATTAGCTATTCAACGTCAACGTGAGGAGACCAAGATCATGCTTACTAGTTTGGATTCAATTACAGATCCAAAAGGACGTGAGTACTTACGAATGAAAAAAAACTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
NAM-associated

Protein Analysis

272

Amino Acids

31.82

Weight (kDa)

8.8

Isoelectric Point (pI)

44.44

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
NAM-associated PF14303 120 - 272 9.6e-17 No apical meristem-associated C-terminal domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 335, 773
AcsI RAATTY 2 cut(s) 43, 245
AcuI CTGAAG 2 cut(s) 279, 659
AfaI GTAC 2 cut(s) 505, 797
AgsI TTSAA 8 cut(s) 90, 209, 368, 432, 529, 653, 725, 771
AhlI ACTAGT 1 cut(s) 758
AjiI CACGTC 1 cut(s) 791
AjnI CCWGG 2 cut(s) 264, 315
AluBI AGCT 2 cut(s) 553, 719
AluI AGCT 2 cut(s) 553, 719
Alw26I GTCTC 3 cut(s) 207, 486, 734
AlwI GGATC 2 cut(s) 335, 773
AoxI GGCC 2 cut(s) 383, 584
ApoI RAATTY 2 cut(s) 43, 245
AspS9I GGNCC 1 cut(s) 411
AsuHPI GGTGA 2 cut(s) 567, 572
AvaII GGWCC 1 cut(s) 411
BbsI GAAGAC 1 cut(s) 546
BccI CCATC 1 cut(s) 39
BciT130I CCWGG 2 cut(s) 266, 317
BcoDI GTCTC 3 cut(s) 207, 486, 734
BcuI ACTAGT 1 cut(s) 758
BfaI CTAG 2 cut(s) 335, 759
BmcAI AGTACT 1 cut(s) 797
Bme1390I CCNGG 2 cut(s) 266, 317
Bme18I GGWCC 1 cut(s) 411
BmgBI CACGTC 1 cut(s) 791
BmgT120I GGNCC 1 cut(s) 411
BmrFI CCNGG 2 cut(s) 266, 317
BmsI GCATC 3 cut(s) 177, 388, 713
BpiI GAAGAC 1 cut(s) 546
BpuEI CTTGAG 2 cut(s) 377, 442
BsaBI GATNNNNATC 1 cut(s) 472
BsaI GGTCTC 1 cut(s) 734
BsaJI CCNNGG 1 cut(s) 315
Bse118I RCCGGY 1 cut(s) 582
Bse8I GATNNNNATC 1 cut(s) 472
BseBI CCWGG 2 cut(s) 266, 317
BseDI CCNNGG 1 cut(s) 315
BseGI GGATG 2 cut(s) 181, 403
BseJI GATNNNNATC 1 cut(s) 472
BseMII CTCAG 1 cut(s) 110
BseRI GAGGAG 1 cut(s) 752
BshFI GGCC 2 cut(s) 385, 586
BsiSI CCGG 1 cut(s) 583
BsmAI GTCTC 3 cut(s) 207, 486, 734
BsmBI CGTCTC 1 cut(s) 486
BsmI GAATGC 1 cut(s) 535
BsnI GGCC 2 cut(s) 385, 586
Bso31I GGTCTC 1 cut(s) 734
Bsp143I GATC 6 cut(s) 61, 223, 340, 373, 747, 778
BspANI GGCC 2 cut(s) 385, 586
BspCNI CTCAG 1 cut(s) 109
BspPI GGATC 2 cut(s) 335, 773
BspTNI GGTCTC 1 cut(s) 734
BsrFI RCCGGY 1 cut(s) 582
BssAI RCCGGY 1 cut(s) 582
BssECI CCNNGG 1 cut(s) 315
BssMI GATC 6 cut(s) 61, 223, 340, 373, 747, 778
Bst2UI CCWGG 2 cut(s) 266, 317
Bst4CI ACNGT 1 cut(s) 52
Bst6I CTCTTC 1 cut(s) 210
BstDEI CTNAG 2 cut(s) 96, 687
BstF5I GGATG 2 cut(s) 181, 403
BstKTI GATC 6 cut(s) 64, 226, 343, 376, 750, 781
BstMAI GTCTC 3 cut(s) 207, 486, 734
BstMBI GATC 6 cut(s) 61, 223, 340, 373, 747, 778
BstNI CCWGG 2 cut(s) 266, 317
BstSCI CCNGG 2 cut(s) 264, 315
BstV2I GAAGAC 1 cut(s) 546
BstX2I RGATCY 1 cut(s) 778
BstYI RGATCY 1 cut(s) 778
BsuRI GGCC 2 cut(s) 385, 586
BtrI CACGTC 1 cut(s) 791
BtsCI GGATG 2 cut(s) 181, 403
Cfr10I RCCGGY 1 cut(s) 582
Cfr13I GGNCC 1 cut(s) 411
CseI GACGC 1 cut(s) 184
Csp6I GTAC 2 cut(s) 504, 796
CspCI CAANNNNNGTGG 2 cut(s) 232, 267
CviAII CATG 3 cut(s) 377, 692, 751
CviJI RGCY 4 cut(s) 385, 553, 586, 719
CviKI_1 RGCY 4 cut(s) 385, 553, 586, 719
CviQI GTAC 2 cut(s) 504, 796
DdeI CTNAG 2 cut(s) 96, 687
DpnI GATC 6 cut(s) 63, 225, 342, 375, 749, 780
DpnII GATC 6 cut(s) 61, 223, 340, 373, 747, 778
Eam1104I CTCTTC 1 cut(s) 210
EarI CTCTTC 1 cut(s) 210
Eco31I GGTCTC 1 cut(s) 734
Eco47I GGWCC 1 cut(s) 411
Eco57I CTGAAG 2 cut(s) 279, 659
EcoRII CCWGG 2 cut(s) 264, 315
EcoT22I ATGCAT 1 cut(s) 706
Esp3I CGTCTC 1 cut(s) 486
FaeI CATG 3 cut(s) 380, 695, 754
FalI AAGNNNNNCTT 2 cut(s) 277, 309
FatI CATG 3 cut(s) 376, 691, 750
FokI GGATG 2 cut(s) 188, 410
FspBI CTAG 2 cut(s) 335, 759
HaeIII GGCC 2 cut(s) 385, 586
HapII CCGG 1 cut(s) 583
HgaI GACGC 1 cut(s) 184
Hin1II CATG 3 cut(s) 380, 695, 754
HincII GTYRAC 1 cut(s) 731
HindII GTYRAC 1 cut(s) 731
HinfI GANTC 5 cut(s) 101, 280, 473, 623, 767
HpaII CCGG 1 cut(s) 583
HphI GGTGA 2 cut(s) 567, 572
Hpy166II GTNNAC 2 cut(s) 257, 731
Hpy188I TCNGA 3 cut(s) 223, 279, 298
Hpy188III TCNNGA 1 cut(s) 98
Hpy8I GTNNAC 2 cut(s) 257, 731
HpyAV CCTTC 3 cut(s) 104, 458, 634
HpyCH4III ACNGT 1 cut(s) 52
HpyCH4IV ACGT 4 cut(s) 479, 727, 733, 790
HpyCH4V TGCA 2 cut(s) 533, 704
HpyF3I CTNAG 2 cut(s) 96, 687
HpySE526I ACGT 4 cut(s) 479, 727, 733, 790
Hsp92II CATG 3 cut(s) 380, 695, 754
Kzo9I GATC 6 cut(s) 61, 223, 340, 373, 747, 778
LpnPI CCDG 9 cut(s) 83, 83, 197, 251, 278, 302, 329, 486, 596
LweI GCATC 3 cut(s) 177, 388, 713
MaeI CTAG 2 cut(s) 335, 759
MaeII ACGT 4 cut(s) 479, 727, 733, 790
MaeIII GTNAC 1 cut(s) 645
MalI GATC 6 cut(s) 63, 225, 342, 375, 749, 780
MboI GATC 6 cut(s) 61, 223, 340, 373, 747, 778
MboII GAAGA 4 cut(s) 71, 197, 370, 551
MflI RGATCY 1 cut(s) 778
MluCI AATT 9 cut(s) 43, 90, 245, 368, 451, 523, 603, 713, 771
MmeI TCCRAC 2 cut(s) 645, 651
MnlI CCTC 5 cut(s) 583, 588, 688, 694, 730
Mph1103I ATGCAT 1 cut(s) 706
MseI TTAA 2 cut(s) 117, 228
MspI CCGG 1 cut(s) 583
MspR9I CCNGG 2 cut(s) 266, 317
Mva1269I GAATGC 1 cut(s) 535
MvaI CCWGG 2 cut(s) 266, 317
NdeII GATC 6 cut(s) 61, 223, 340, 373, 747, 778
NlaIII CATG 3 cut(s) 380, 695, 754
NsiI ATGCAT 1 cut(s) 706
PctI GAATGC 1 cut(s) 535
PfeI GAWTC 5 cut(s) 101, 280, 473, 623, 767
Psp6I CCWGG 2 cut(s) 264, 315
PspGI CCWGG 2 cut(s) 264, 315
PspPI GGNCC 1 cut(s) 411
PsuI RGATCY 1 cut(s) 778
RsaI GTAC 2 cut(s) 505, 797
RsaNI GTAC 2 cut(s) 504, 796
SaqAI TTAA 2 cut(s) 117, 228
Sau3AI GATC 6 cut(s) 61, 223, 340, 373, 747, 778
Sau96I GGNCC 1 cut(s) 411
ScaI AGTACT 1 cut(s) 797
ScrFI CCNGG 2 cut(s) 266, 317
SfaNI GCATC 3 cut(s) 177, 388, 713
SinI GGWCC 1 cut(s) 411
SmlI CTYRAG 2 cut(s) 392, 457
SmoI CTYRAG 2 cut(s) 392, 457
SpeI ACTAGT 1 cut(s) 758
Sse9I AATT 9 cut(s) 43, 90, 245, 368, 451, 523, 603, 713, 771
SspMI CTAG 2 cut(s) 335, 759
StyD4I CCNGG 2 cut(s) 264, 315
TaaI ACNGT 1 cut(s) 52
TaiI ACGT 4 cut(s) 482, 730, 736, 793
TaqI TCGA 3 cut(s) 34, 108, 214
TasI AATT 9 cut(s) 43, 90, 245, 368, 451, 523, 603, 713, 771
TatI WGTACW 1 cut(s) 795
TfiI GAWTC 5 cut(s) 101, 280, 473, 623, 767
Tru1I TTAA 2 cut(s) 117, 228
Tru9I TTAA 2 cut(s) 117, 228
TspDTI ATGAA 4 cut(s) 192, 486, 552, 579
VpaK11BI GGWCC 1 cut(s) 411
XapI RAATTY 2 cut(s) 43, 245
XspI CTAG 2 cut(s) 335, 759
ZrmI AGTACT 1 cut(s) 797
Zsp2I ATGCAT 1 cut(s) 706
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.