Basic Information

Type: gene

Biological Identity

Species

rosa_laevigata

Chromosome

Chr2

Orthogroup ID

OG0004807

Physical Location & Seq

Genomic Coordinates Reverse (-)

63995479 .. 63995992

Gene Structure 514 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

RLM00000010191

Sequence Viewer

CDS Protein Promoter (2k)

Length: 429 bp

ATGGCACCACTAAACATGAGCAACATTGCTCAATTGGGTGGTGGAAACATCAATTTGGGTGGGGAAGTCAAGAGGGGGATTAACCATGACCTCAGCGCCATGATGAATTTGGCTGGCTTTCATGGCAGTGGCACCGCAAATGCTGCTACTTCTGCTGCTGGTTTAGGTGGCAATCCCGACGCTAGTCTAGCAGCATTGCAACAAGCCTTCAATCTCAACAAGCTCAAGCAGCAGGCAGTGGATATCAGGCTCAAGCAGATTCTGGAGGCTAGGATGATGAACATAAATATGCAGGCGAGGCAAGCAATGCAGCAGCAGCAAGCTCGGATGATGTATGATAGGTCTCCACTCATTCCTCCTAGTACTACTGGTTATTACCACAACTATGGTCCTACTACTAGTTCTGCTTCATATCTACGGGGATGGTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

HMA

Protein Analysis

143

Amino Acids

15.22

Weight (kDa)

9.89

Isoelectric Point (pI)

53.48

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0004807)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G23000 AT1G23000
fragaria_vesca	FvH4_4g32260
malus_domestica	MD16G1029800.v1.1
prunus_persica	Prupe.1G323100_v2.0.a1 Prupe.3G152200_v2.0.a1
pyrus_communis	pycom05g25530 pycom13g02530 pycom16g02540
rosa_chinensis	RchiOBHm_Chr4g0441051
rosa_laevigata	RLG00000006124 RLG00000010191 RLG00000010192
rosa_multiflora	Rmu_sc0000424.1_g000043 Rmu_sc0002157.1_g000027 Rmu_sc0002157.1_g000028 Rmu_sc0007363.1_g000002 Rmu_sc0009497.1_g000005 Rmu_sc0024852.1_g000001 Rmu_sc0039859.1_g000001
rosa_roxburghii	Rroxscaffold_5G00381970
rosa_rugosa	Rorug03G0304900 Rorug04G0330400
rosa_samantha	Rh2DG461600 Rh4AG008900 Rh4AG382100 Rh4BG395700 Rh4CG410800 Rh4DG388800
rosa_wichuraiana	Rw4G000240 Rw4G032960

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB1I	GGYRCC	2 cut(s)	4, 131
AciI	CCGC	1 cut(s)	135
AcsI	RAATTY	1 cut(s)	106
AfaI	GTAC	1 cut(s)	364
AgsI	TTSAA	1 cut(s)	211
AhlI	ACTAGT	1 cut(s)	398
AluBI	AGCT	2 cut(s)	223, 323
AluI	AGCT	2 cut(s)	223, 323
Alw26I	GTCTC	1 cut(s)	348
AlwNI	CAGNNNCTG	1 cut(s)	262
ApeKI	GCWGC	7 cut(s)	143, 155, 191, 229, 310, 313, 316
ApoI	RAATTY	1 cut(s)	106
AspLEI	GCGC	1 cut(s)	98
AspS9I	GGNCC	1 cut(s)	389
AvaII	GGWCC	1 cut(s)	389
BanI	GGYRCC	2 cut(s)	4, 131
BbvCI	CCTCAGC	1 cut(s)	92
BbvI	GCAGC	7 cut(s)	130, 142, 203, 241, 322, 325, 328
BccI	CCATC	1 cut(s)	417
BcgI	CGANNNNNNTGC	2 cut(s)	305, 339
BcoDI	GTCTC	1 cut(s)	348
BcuI	ACTAGT	1 cut(s)	398
BfaI	CTAG	5 cut(s)	183, 188, 270, 360, 399
BfoI	RGCGCY	1 cut(s)	99
BisI	GCNGC	7 cut(s)	144, 156, 192, 230, 311, 314, 317
BlsI	GCNGC	7 cut(s)	145, 157, 193, 231, 312, 315, 318
BmcAI	AGTACT	1 cut(s)	364
Bme18I	GGWCC	1 cut(s)	389
BmgT120I	GGNCC	1 cut(s)	389
BmiI	GGNNCC	2 cut(s)	6, 133
BoxI	GACNNNNGTC	1 cut(s)	183
BpmI	CTGGAG	1 cut(s)	284
Bpu10I	CCTNAGC	1 cut(s)	92
BpuEI	CTTGAG	2 cut(s)	209, 236
BsaI	GGTCTC	1 cut(s)	348
Bse1I	ACTGG	1 cut(s)	373
Bse3DI	GCAATG	3 cut(s)	24, 194, 312
BseGI	GGATG	3 cut(s)	279, 333, 428
BseMI	GCAATG	3 cut(s)	24, 194, 312
BseMII	CTCAG	1 cut(s)	106
BseNI	ACTGG	1 cut(s)	373
BseXI	GCAGC	7 cut(s)	130, 142, 203, 241, 322, 325, 328
BshNI	GGYRCC	2 cut(s)	4, 131
BsmAI	GTCTC	1 cut(s)	348
Bso31I	GGTCTC	1 cut(s)	348
BspACI	CCGC	1 cut(s)	135
BspCNI	CTCAG	1 cut(s)	105
BspLI	GGNNCC	2 cut(s)	6, 133
BspT107I	GGYRCC	2 cut(s)	4, 131
BspTNI	GGTCTC	1 cut(s)	348
BsrDI	GCAATG	3 cut(s)	24, 194, 312
BsrI	ACTGG	1 cut(s)	373
BstAPI	GCANNNNNTGC	2 cut(s)	143, 307
BstC8I	GCNNGC	5 cut(s)	115, 234, 294, 303, 321
BstDEI	CTNAG	1 cut(s)	92
BstF5I	GGATG	3 cut(s)	279, 333, 428
BstH2I	RGCGCY	1 cut(s)	99
BstHHI	GCGC	1 cut(s)	98
BstMAI	GTCTC	1 cut(s)	348
BstMWI	GCNNNNNNNGC	9 cut(s)	123, 143, 152, 188, 229, 298, 302, 307, 316
BstPAI	GACNNNNGTC	1 cut(s)	183
BstV1I	GCAGC	7 cut(s)	130, 142, 203, 241, 322, 325, 328
BstXI	CCANNNNNNTGG	1 cut(s)	386
BtsCI	GGATG	3 cut(s)	279, 333, 428
BtsI	GCAGTG	2 cut(s)	133, 243
BtsIMutI	CAGTG	2 cut(s)	133, 243
Cac8I	GCNNGC	5 cut(s)	115, 234, 294, 303, 321
CaiI	CAGNNNCTG	1 cut(s)	262
CfoI	GCGC	1 cut(s)	98
Cfr13I	GGNCC	1 cut(s)	389
CseI	GACGC	1 cut(s)	188
Csp6I	GTAC	1 cut(s)	363
CspCI	CAANNNNNGTGG	2 cut(s)	40, 75
CviAII	CATG	4 cut(s)	16, 86, 100, 122
CviJI	RGCY	7 cut(s)	113, 117, 206, 223, 250, 269, 323
CviKI_1	RGCY	7 cut(s)	113, 117, 206, 223, 250, 269, 323
CviQI	GTAC	1 cut(s)	363
DdeI	CTNAG	1 cut(s)	92
Eco31I	GGTCTC	1 cut(s)	348
Eco32I	GATATC	1 cut(s)	244
Eco47I	GGWCC	1 cut(s)	389
EcoRV	GATATC	1 cut(s)	244
FaeI	CATG	4 cut(s)	19, 89, 103, 125
FaiI	YATR	9 cut(s)	17, 87, 101, 123, 284, 290, 336, 387, 412
FatI	CATG	4 cut(s)	15, 85, 99, 121
Fnu4HI	GCNGC	7 cut(s)	144, 156, 192, 230, 311, 314, 317
FokI	GGATG	2 cut(s)	286, 340
Fsp4HI	GCNGC	7 cut(s)	144, 156, 192, 230, 311, 314, 317
FspBI	CTAG	5 cut(s)	183, 188, 270, 360, 399
GlaI	GCGC	1 cut(s)	97
GluI	GCNGC	7 cut(s)	144, 156, 192, 230, 311, 314, 317
GsuI	CTGGAG	1 cut(s)	284
HaeII	RGCGCY	1 cut(s)	99
HgaI	GACGC	1 cut(s)	188
HhaI	GCGC	1 cut(s)	98
Hin1II	CATG	4 cut(s)	19, 89, 103, 125
Hin6I	GCGC	1 cut(s)	96
HinP1I	GCGC	1 cut(s)	96
HinfI	GANTC	1 cut(s)	259
Hpy188I	TCNGA	1 cut(s)	327
Hpy188III	TCNNGA	3 cut(s)	70, 176, 263
Hpy99I	CGWCG	1 cut(s)	182
HpyAV	CCTTC	1 cut(s)	217
HpyCH4V	TGCA	3 cut(s)	199, 292, 310
HpyF10VI	GCNNNNNNNGC	9 cut(s)	123, 143, 152, 188, 229, 298, 302, 307, 316
HpyF3I	CTNAG	1 cut(s)	92
Hsp92II	CATG	4 cut(s)	19, 89, 103, 125
HspAI	GCGC	1 cut(s)	96
LpnPI	CCDG	7 cut(s)	99, 144, 218, 232, 248, 278, 354
Lsp1109I	GCAGC	7 cut(s)	130, 142, 203, 241, 322, 325, 328
MaeI	CTAG	5 cut(s)	183, 188, 270, 360, 399
MfeI	CAATTG	1 cut(s)	32
MluCI	AATT	3 cut(s)	32, 52, 106
MnlI	CCTC	5 cut(s)	66, 101, 259, 291, 366
MseI	TTAA	1 cut(s)	81
MslI	CAYNNNNRTG	3 cut(s)	126, 287, 384
MunI	CAATTG	1 cut(s)	32
MwoI	GCNNNNNNNGC	9 cut(s)	123, 143, 152, 188, 229, 298, 302, 307, 316
NlaIII	CATG	4 cut(s)	19, 89, 103, 125
NlaIV	GGNNCC	2 cut(s)	6, 133
PfeI	GAWTC	1 cut(s)	259
PkrI	GCNGC	7 cut(s)	145, 157, 193, 231, 312, 315, 318
PshAI	GACNNNNGTC	1 cut(s)	183
PspN4I	GGNNCC	2 cut(s)	6, 133
PspPI	GGNCC	1 cut(s)	389
PstNI	CAGNNNCTG	1 cut(s)	262
RsaI	GTAC	1 cut(s)	364
RsaNI	GTAC	1 cut(s)	363
RseI	CAYNNNNRTG	3 cut(s)	126, 287, 384
SaqAI	TTAA	1 cut(s)	81
SatI	GCNGC	7 cut(s)	144, 156, 192, 230, 311, 314, 317
Sau96I	GGNCC	1 cut(s)	389
ScaI	AGTACT	1 cut(s)	364
SetI	ASST	5 cut(s)	93, 169, 225, 325, 344
SinI	GGWCC	1 cut(s)	389
SmiMI	CAYNNNNRTG	3 cut(s)	126, 287, 384
SmlI	CTYRAG	2 cut(s)	224, 251
SmoI	CTYRAG	2 cut(s)	224, 251
SpeI	ACTAGT	1 cut(s)	398
Sse9I	AATT	3 cut(s)	32, 52, 106
SsiI	CCGC	1 cut(s)	135
SspMI	CTAG	5 cut(s)	183, 188, 270, 360, 399
TasI	AATT	3 cut(s)	32, 52, 106
TatI	WGTACW	1 cut(s)	362
TfiI	GAWTC	1 cut(s)	259
Tru1I	TTAA	1 cut(s)	81
Tru9I	TTAA	1 cut(s)	81
TscAI	CASTG	2 cut(s)	133, 243
TseI	GCWGC	7 cut(s)	143, 155, 191, 229, 310, 313, 316
TspDTI	ATGAA	4 cut(s)	110, 119, 293, 399
TspRI	CASTG	2 cut(s)	133, 243
VpaK11BI	GGWCC	1 cut(s)	389
XapI	RAATTY	1 cut(s)	106
XcmI	CCANNNNNNNNNTGG	1 cut(s)	106
XspI	CTAG	5 cut(s)	183, 188, 270, 360, 399
ZrmI	AGTACT	1 cut(s)	364

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.