Rmu_sc0002157.1_g000027
ERF Family

heavy metal transport detoxification superfamily protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002157.1
Physical Location & Seq
Forward (+)
120447 .. 120941
495 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002157.1_g000027.1.cds

Sequence Viewer

Length: 495 bp
atgactaaagatgaagactttaaactcctcgaggtccagacttgtgttctcaaagtgaacatacactttgatgggtgtaagcaggaagtaaagaaactgcttcagagaattgaaggtgtttaccaagtcagcatagatgctgatcagcagaaagtcacagtttcaggggttatagactctgccactttgatcaagaaattggttagagatgggacacatgctgagctttggtcccagcagaaggccaatcagaaccaaaaccagaagcaaaagaataccaactgcatcaaggacaacaaaggccaaaagcagcaggggtgcataataaagggccgtgaagcaatcaaaaacctgctgcagcagaagttccccaatttccttactgaagaggatattgatgacttcttggacgacgatgaggaggaggatgaagaggataagttgaggtttctggggcagaaaatgaaccagcgactgatgcaaacaacaatgtaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

164

Amino Acids

19.02

Weight (kDa)

5.32

Isoelectric Point (pI)

36.55

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AbsI CCTCGAGG 1 cut(s) 29
Acc36I ACCTGC 1 cut(s) 360
AcuI CTGAAG 2 cut(s) 86, 405
AfiI CCNNNNNNNGG 1 cut(s) 241
AgsI TTSAA 1 cut(s) 113
AluBI AGCT 1 cut(s) 226
AluI AGCT 1 cut(s) 226
AlwNI CAGNNNCTG 1 cut(s) 475
Ama87I CYCGRG 1 cut(s) 29
AoxI GGCC 3 cut(s) 243, 301, 331
ApeKI GCWGC 3 cut(s) 310, 355, 358
AspS9I GGNCC 3 cut(s) 34, 231, 331
AvaI CYCGRG 1 cut(s) 29
AvaII GGWCC 2 cut(s) 34, 231
BbsI GAAGAC 1 cut(s) 21
BbvI GCAGC 3 cut(s) 322, 342, 370
BccI CCATC 2 cut(s) 65, 203
BceAI ACGGC 1 cut(s) 318
BclI TGATCA 2 cut(s) 142, 189
BfmI CTRYAG 1 cut(s) 356
BfuAI ACCTGC 1 cut(s) 360
BisI GCNGC 3 cut(s) 311, 356, 359
BlpI GCTNAGC 1 cut(s) 222
BlsI GCNGC 3 cut(s) 312, 357, 360
Bme18I GGWCC 2 cut(s) 34, 231
BmeT110I CYCGRG 1 cut(s) 29
BmgT120I GGNCC 3 cut(s) 34, 231, 331
BmiI GGNNCC 1 cut(s) 233
BmsI GCATC 3 cut(s) 127, 294, 468
BpiI GAAGAC 1 cut(s) 21
Bpu1102I GCTNAGC 1 cut(s) 222
BsaBI GATNNNNATC 1 cut(s) 141
Bsc4I CCNNNNNNNGG 1 cut(s) 241
Bse8I GATNNNNATC 1 cut(s) 141
BseGI GGATG 1 cut(s) 433
BseJI GATNNNNATC 1 cut(s) 141
BseLI CCNNNNNNNGG 1 cut(s) 241
BseMII CTCAG 1 cut(s) 213
BseRI GAGGAG 3 cut(s) 17, 434, 437
BseXI GCAGC 3 cut(s) 322, 342, 370
BseYI CCCAGC 1 cut(s) 234
BshFI GGCC 3 cut(s) 245, 303, 333
BsiHKCI CYCGRG 1 cut(s) 29
BslFI GGGAC 2 cut(s) 217, 226
BslI CCNNNNNNNGG 1 cut(s) 241
BsmFI GGGAC 2 cut(s) 217, 226
BsnI GGCC 3 cut(s) 245, 303, 333
BsoBI CYCGRG 1 cut(s) 29
Bsp143I GATC 2 cut(s) 142, 189
Bsp1720I GCTNAGC 1 cut(s) 222
BspANI GGCC 3 cut(s) 245, 303, 333
BspCNI CTCAG 1 cut(s) 214
BspLI GGNNCC 1 cut(s) 233
BspMAI CTGCAG 1 cut(s) 360
BspMI ACCTGC 1 cut(s) 360
BssMI GATC 2 cut(s) 142, 189
Bst4CI ACNGT 1 cut(s) 160
Bst6I CTCTTC 2 cut(s) 381, 426
BstDEI CTNAG 1 cut(s) 222
BstF5I GGATG 1 cut(s) 433
BstKTI GATC 2 cut(s) 145, 192
BstMBI GATC 2 cut(s) 142, 189
BstMWI GCNNNNNNNGC 1 cut(s) 478
BstNSI RCATGY 1 cut(s) 221
BstSFI CTRYAG 1 cut(s) 356
BstV1I GCAGC 3 cut(s) 322, 342, 370
BstV2I GAAGAC 1 cut(s) 21
BsuRI GGCC 3 cut(s) 245, 303, 333
BtsCI GGATG 1 cut(s) 433
BveI ACCTGC 1 cut(s) 360
CaiI CAGNNNCTG 1 cut(s) 475
Cfr13I GGNCC 3 cut(s) 34, 231, 331
CviAII CATG 1 cut(s) 218
CviJI RGCY 4 cut(s) 226, 245, 303, 333
CviKI_1 RGCY 4 cut(s) 226, 245, 303, 333
DdeI CTNAG 1 cut(s) 222
DpnI GATC 2 cut(s) 144, 191
DpnII GATC 2 cut(s) 142, 189
DraI TTTAAA 1 cut(s) 22
Eam1104I CTCTTC 2 cut(s) 381, 426
EarI CTCTTC 2 cut(s) 381, 426
Eco47I GGWCC 2 cut(s) 34, 231
Eco57I CTGAAG 2 cut(s) 86, 405
Eco88I CYCGRG 1 cut(s) 29
FaeI CATG 1 cut(s) 221
FaiI YATR 5 cut(s) 62, 134, 173, 219, 323
FaqI GGGAC 2 cut(s) 217, 226
FatI CATG 1 cut(s) 217
FbaI TGATCA 2 cut(s) 142, 189
Fnu4HI GCNGC 3 cut(s) 311, 356, 359
FokI GGATG 1 cut(s) 440
Fsp4HI GCNGC 3 cut(s) 311, 356, 359
GluI GCNGC 3 cut(s) 311, 356, 359
GsaI CCCAGC 1 cut(s) 238
HaeIII GGCC 3 cut(s) 245, 303, 333
Hin1II CATG 1 cut(s) 221
HinfI GANTC 1 cut(s) 176
Hpy166II GTNNAC 2 cut(s) 58, 121
Hpy188I TCNGA 2 cut(s) 105, 252
Hpy188III TCNNGA 2 cut(s) 37, 193
Hpy8I GTNNAC 2 cut(s) 58, 121
Hpy99I CGWCG 1 cut(s) 416
HpyAV CCTTC 2 cut(s) 107, 235
HpyCH4III ACNGT 1 cut(s) 160
HpyCH4V TGCA 4 cut(s) 285, 321, 358, 481
HpyF10VI GCNNNNNNNGC 1 cut(s) 478
HpyF3I CTNAG 1 cut(s) 222
Hsp92II CATG 1 cut(s) 221
Ksp22I TGATCA 2 cut(s) 142, 189
Kzo9I GATC 2 cut(s) 142, 189
LpnPI CCDG 9 cut(s) 50, 68, 150, 248, 275, 299, 365, 437, 482
Lsp1109I GCAGC 3 cut(s) 322, 342, 370
LweI GCATC 3 cut(s) 127, 294, 468
MaeIII GTNAC 1 cut(s) 154
MalI GATC 2 cut(s) 144, 191
MboI GATC 2 cut(s) 142, 189
MboII GAAGA 3 cut(s) 26, 398, 443
MluCI AATT 3 cut(s) 108, 197, 373
MlyI GAGTC 1 cut(s) 170
MnlI CCTC 8 cut(s) 25, 38, 382, 412, 415, 418, 427, 438
MseI TTAA 1 cut(s) 21
MslI CAYNNNNRTG 1 cut(s) 69
MwoI GCNNNNNNNGC 1 cut(s) 478
NdeII GATC 2 cut(s) 142, 189
NlaIII CATG 1 cut(s) 221
NlaIV GGNNCC 1 cut(s) 233
NmuCI GTSAC 1 cut(s) 154
NspI RCATGY 1 cut(s) 221
PaeR7I CTCGAG 1 cut(s) 29
PkrI GCNGC 3 cut(s) 312, 357, 360
PleI GAGTC 1 cut(s) 170
PpsI GAGTC 1 cut(s) 170
PspFI CCCAGC 1 cut(s) 234
PspN4I GGNNCC 1 cut(s) 233
PspPI GGNCC 3 cut(s) 34, 231, 331
PspXI VCTCGAGB 1 cut(s) 29
PstI CTGCAG 1 cut(s) 360
PstNI CAGNNNCTG 1 cut(s) 475
RseI CAYNNNNRTG 1 cut(s) 69
SaqAI TTAA 1 cut(s) 21
SatI GCNGC 3 cut(s) 311, 356, 359
Sau3AI GATC 2 cut(s) 142, 189
Sau96I GGNCC 3 cut(s) 34, 231, 331
SchI GAGTC 1 cut(s) 170
SetI ASST 5 cut(s) 36, 118, 228, 354, 449
SfaNI GCATC 3 cut(s) 127, 294, 468
SfcI CTRYAG 1 cut(s) 356
Sfr274I CTCGAG 1 cut(s) 29
SinI GGWCC 2 cut(s) 34, 231
SlaI CTCGAG 1 cut(s) 29
SmiMI CAYNNNNRTG 1 cut(s) 69
SmlI CTYRAG 1 cut(s) 29
SmoI CTYRAG 1 cut(s) 29
Sse9I AATT 3 cut(s) 108, 197, 373
TaaI ACNGT 1 cut(s) 160
TaqI TCGA 1 cut(s) 30
TasI AATT 3 cut(s) 108, 197, 373
Tru1I TTAA 1 cut(s) 21
Tru9I TTAA 1 cut(s) 21
TseFI GTSAC 1 cut(s) 154
TseI GCWGC 3 cut(s) 310, 355, 358
Tsp45I GTSAC 1 cut(s) 154
TspDTI ATGAA 3 cut(s) 27, 444, 479
VpaK11BI GGWCC 2 cut(s) 34, 231
XceI RCATGY 1 cut(s) 221
XhoI CTCGAG 1 cut(s) 29
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.