Rh2DG461600

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2D
Physical Location & Seq
Reverse (-)
66635606 .. 66635838
233 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2DG461600.1

Sequence Viewer

Length: 233 bp
ATGGGAAAGAAACTCCTTCAGAGAATTGAAGGTGTTTACCACGTCAATATTGATGCTGAACAGCAGAGTCACAGTTTCAGGAGTCATAGACTCTGCCACTTTGATCAAGAAATTGCTATGAGCTGGGAAACATTCTGTGATCCAAACCAGGAGAAAAGACCATCAATAATGAAGCAGACAAGGCAAGCAAATGAACCAATGCAGCACCAACAACCACAGATGATGTATCACAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

77

Amino Acids

9.3

Weight (kDa)

7.01

Isoelectric Point (pI)

88.33

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 134
AgsI TTSAA 1 cut(s) 29
AjiI CACGTC 1 cut(s) 43
AjnI CCWGG 1 cut(s) 147
AluBI AGCT 1 cut(s) 123
AluI AGCT 1 cut(s) 123
AlwI GGATC 1 cut(s) 134
ApeKI GCWGC 1 cut(s) 202
BbvI GCAGC 1 cut(s) 214
BccI CCATC 1 cut(s) 169
BciT130I CCWGG 1 cut(s) 149
BclI TGATCA 1 cut(s) 103
BisI GCNGC 1 cut(s) 203
BlsI GCNGC 1 cut(s) 204
Bme1390I CCNGG 1 cut(s) 149
BmgBI CACGTC 1 cut(s) 43
BmrFI CCNGG 1 cut(s) 149
BmsI GCATC 1 cut(s) 43
BseBI CCWGG 1 cut(s) 149
BseXI GCAGC 1 cut(s) 214
BseYI CCCAGC 1 cut(s) 123
Bsp143I GATC 2 cut(s) 103, 139
BspPI GGATC 1 cut(s) 134
BssMI GATC 2 cut(s) 103, 139
Bst2UI CCWGG 1 cut(s) 149
Bst4CI ACNGT 1 cut(s) 74
BstC8I GCNNGC 1 cut(s) 186
BstKTI GATC 2 cut(s) 106, 142
BstMBI GATC 2 cut(s) 103, 139
BstMWI GCNNNNNNNGC 1 cut(s) 181
BstNI CCWGG 1 cut(s) 149
BstSCI CCNGG 1 cut(s) 147
BstV1I GCAGC 1 cut(s) 214
BtrI CACGTC 1 cut(s) 43
Cac8I GCNNGC 1 cut(s) 186
CviJI RGCY 1 cut(s) 123
CviKI_1 RGCY 1 cut(s) 123
DpnI GATC 2 cut(s) 105, 141
DpnII GATC 2 cut(s) 103, 139
EcoRII CCWGG 1 cut(s) 147
FaiI YATR 2 cut(s) 87, 119
FbaI TGATCA 1 cut(s) 103
Fnu4HI GCNGC 1 cut(s) 203
Fsp4HI GCNGC 1 cut(s) 203
GluI GCNGC 1 cut(s) 203
GsaI CCCAGC 1 cut(s) 127
HinfI GANTC 3 cut(s) 67, 82, 90
Hpy166II GTNNAC 1 cut(s) 37
Hpy188I TCNGA 1 cut(s) 21
Hpy188III TCNNGA 2 cut(s) 79, 107
Hpy8I GTNNAC 1 cut(s) 37
HpyAV CCTTC 2 cut(s) 23, 26
HpyCH4III ACNGT 1 cut(s) 74
HpyCH4IV ACGT 1 cut(s) 42
HpyCH4V TGCA 1 cut(s) 202
HpyF10VI GCNNNNNNNGC 1 cut(s) 181
HpySE526I ACGT 1 cut(s) 42
Ksp22I TGATCA 1 cut(s) 103
Kzo9I GATC 2 cut(s) 103, 139
LpnPI CCDG 4 cut(s) 64, 109, 134, 161
Lsp1109I GCAGC 1 cut(s) 214
LweI GCATC 1 cut(s) 43
MaeII ACGT 1 cut(s) 42
MaeIII GTNAC 1 cut(s) 68
MalI GATC 2 cut(s) 105, 141
MboI GATC 2 cut(s) 103, 139
MluCI AATT 2 cut(s) 24, 111
MlyI GAGTC 3 cut(s) 76, 84, 91
MspR9I CCNGG 1 cut(s) 149
MvaI CCWGG 1 cut(s) 149
MwoI GCNNNNNNNGC 1 cut(s) 181
NdeII GATC 2 cut(s) 103, 139
NmuCI GTSAC 1 cut(s) 68
PkrI GCNGC 1 cut(s) 204
PleI GAGTC 3 cut(s) 75, 84, 90
PpsI GAGTC 3 cut(s) 75, 84, 90
Psp6I CCWGG 1 cut(s) 147
PspFI CCCAGC 1 cut(s) 123
PspGI CCWGG 1 cut(s) 147
SatI GCNGC 1 cut(s) 203
Sau3AI GATC 2 cut(s) 103, 139
SchI GAGTC 3 cut(s) 76, 84, 91
ScrFI CCNGG 1 cut(s) 149
SetI ASST 3 cut(s) 34, 45, 125
SfaNI GCATC 1 cut(s) 43
SgeI CNNG 8 cut(s) 53, 91, 119, 136, 160, 161, 192, 197
Sse9I AATT 2 cut(s) 24, 111
SspI AATATT 1 cut(s) 49
StyD4I CCNGG 1 cut(s) 147
TaaI ACNGT 1 cut(s) 74
TaiI ACGT 1 cut(s) 45
TasI AATT 2 cut(s) 24, 111
TseFI GTSAC 1 cut(s) 68
TseI GCWGC 1 cut(s) 202
Tsp45I GTSAC 1 cut(s) 68
TspDTI ATGAA 2 cut(s) 185, 207
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.