Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0007363.1

Orthogroup ID

OG0004807

Physical Location & Seq

Genomic Coordinates Forward (+)

8987 .. 13812

Gene Structure 4826 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0007363.1_g000002.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1401 bp

atgactaaagatgaagactttaagcttctcaagatccagacttgtgttctcaaagtgaacatacactgcgatgggtgtaagcagaaagtgaagaaactgcttcagagaattgaaggtgtttaccaagtcagcattgatgctgatcagcagaaagtaacaatttcaggggttatagactctgctactttgatcaagaaattggttagagctgggaaacatgctgagctttggtcccagcagaaggccaatcagaaccaaaaccagaagcaaaagaacaccaactgcgtcaaggacaacaaaggccaaaagcagcagggggggataataaagggccttgaagccttcaaaaaccagcagcagctgaagttccccaatttccttactgaagaggatattgatgacttcttggacgacgatgaggaggaggatgaagatgatgagttgaggtttctgaggcagaaagtgaaccagctcaggcatcaagcgattgatgcaaacaacaatgcaaagaaaggtgttgccgctgcagctaatcccaacaatagtgtcaagatcacaaacaatcacaatgctggaaagaagggagtgcagcacccaaatcagaatgtgcagggcatgaaggtgattaatccaggcgggattgatcccaaaaccatggcagcactgaacctgggaaacattgctcaattgggtggggaagtcaagagggggaataaccatgacctcagtgccatgatgaatttggctggctttcatggcaatggtgctgcaaatgctgctacttctgctgctggtatgggtggcaatcccaatgttagtctagcagcattgcaacaagcgcttcaatctcagcaagctcaagctgcaggcagtggatatcaggctcaagcagcttctggagggttccctagtggtggttatgcgacgggccaatatccgcagaccatgatgatgaacacaaatggctacgggcatccgtcacagatgatgaacatgaatatgcaggcaaggcaagcaatgcagcagcagcaacctcagatgatgtatcataggtctccattcagtcctcctagtactactggttattaccacaactatggtcccactcctagttctgttccatatccatacagtgctgagcctaattacaccaacggtgatggcaacaatgcagctcatatgttcaatgatgagaacaccagcagctgttctatcatggatcagattatgaacaaggcgaggtcctactggttcagccagaaggccaccaaggagatctcctccgtcgacgatgacatcaagggaatttatgatgatatgaacttgggattttaccttgttgcatatgatgacattgggggcatttcctaccaaaaggcttgcgacttgcgacttgtctag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

HMA

Protein Analysis

466

Amino Acids

51.05

Weight (kDa)

7.15

Isoelectric Point (pI)

37.08

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0004807)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G23000 AT1G23000
fragaria_vesca	FvH4_4g32260
malus_domestica	MD16G1029800.v1.1
prunus_persica	Prupe.1G323100_v2.0.a1 Prupe.3G152200_v2.0.a1
pyrus_communis	pycom05g25530 pycom13g02530 pycom16g02540
rosa_chinensis	RchiOBHm_Chr4g0441051
rosa_laevigata	RLG00000006124 RLG00000010191 RLG00000010192
rosa_multiflora	Rmu_sc0000424.1_g000043 Rmu_sc0002157.1_g000027 Rmu_sc0002157.1_g000028 Rmu_sc0007363.1_g000002 Rmu_sc0009497.1_g000005 Rmu_sc0024852.1_g000001 Rmu_sc0039859.1_g000001
rosa_roxburghii	Rroxscaffold_5G00381970
rosa_rugosa	Rorug03G0304900 Rorug04G0330400
rosa_samantha	Rh2DG461600 Rh4AG008900 Rh4AG382100 Rh4BG395700 Rh4CG410800 Rh4DG388800
rosa_wichuraiana	Rw4G000240 Rw4G032960

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccI	GTMKAC	1 cut(s)	1287
AciI	CCGC	3 cut(s)	522, 636, 938
AclWI	GGATC	3 cut(s)	28, 638, 1227
AcsI	RAATTY	2 cut(s)	739, 1305
AcuI	CTGAAG	3 cut(s)	86, 383, 405
AfaI	GTAC	1 cut(s)	1075
AfeI	AGCGCT	1 cut(s)	840
AfiI	CCNNNNNNNGG	2 cut(s)	241, 914
AgsI	TTSAA	5 cut(s)	113, 338, 346, 845, 1186
AjnI	CCWGG	2 cut(s)	631, 669
Alw26I	GTCTC	1 cut(s)	1059
AlwI	GGATC	3 cut(s)	28, 638, 1227
AlwNI	CAGNNNCTG	3 cut(s)	361, 896, 1206
Aor51HI	AGCGCT	1 cut(s)	840
AoxI	GGCC	5 cut(s)	243, 301, 331, 928, 1263
ApoI	RAATTY	2 cut(s)	739, 1305
AseI	ATTAAT	1 cut(s)	627
AspLEI	GCGC	1 cut(s)	841
AspS9I	GGNCC	5 cut(s)	231, 331, 928, 1100, 1242
AsuHPI	GGTGA	2 cut(s)	634, 1169
AvaII	GGWCC	3 cut(s)	231, 1100, 1242
BbsI	GAAGAC	1 cut(s)	21
BccI	CCATC	2 cut(s)	65, 1154
BciT130I	CCWGG	2 cut(s)	633, 671
BclI	TGATCA	2 cut(s)	142, 189
BcoDI	GTCTC	1 cut(s)	1059
BfaI	CTAG	5 cut(s)	821, 909, 1071, 1110, 1399
BfmI	CTRYAG	2 cut(s)	525, 864
BfoI	RGCGCY	1 cut(s)	842
BglII	AGATCT	1 cut(s)	1275
BlpI	GCTNAGC	2 cut(s)	222, 1137
BmcAI	AGTACT	1 cut(s)	1075
Bme1390I	CCNGG	2 cut(s)	633, 671
Bme18I	GGWCC	3 cut(s)	231, 1100, 1242
BmgT120I	GGNCC	5 cut(s)	231, 331, 928, 1100, 1242
BmiI	GGNNCC	3 cut(s)	233, 905, 1102
BmrFI	CCNGG	2 cut(s)	633, 671
BmsI	GCATC	4 cut(s)	127, 481, 487, 982
BpiI	GAAGAC	1 cut(s)	21
BplI	GAGNNNNNCTC	2 cut(s)	1265, 1297
BpmI	CTGGAG	1 cut(s)	918
Bpu10I	CCTNAGC	1 cut(s)	473
Bpu1102I	GCTNAGC	2 cut(s)	222, 1137
BpuEI	CTTGAG	3 cut(s)	14, 843, 870
BsaBI	GATNNNNATC	1 cut(s)	141
BsaI	GGTCTC	1 cut(s)	1059
BsaJI	CCNNGG	3 cut(s)	654, 670, 1269
Bsc4I	CCNNNNNNNGG	2 cut(s)	241, 914
Bse1I	ACTGG	2 cut(s)	1084, 1253
Bse3DI	GCAATG	4 cut(s)	678, 766, 827, 1023
Bse8I	GATNNNNATC	1 cut(s)	141
BseBI	CCWGG	2 cut(s)	633, 671
BseDI	CCNNGG	3 cut(s)	654, 670, 1269
BseGI	GGATG	2 cut(s)	433, 973
BseJI	GATNNNNATC	1 cut(s)	141
BseLI	CCNNNNNNNGG	2 cut(s)	241, 914
BseMI	GCAATG	4 cut(s)	678, 766, 827, 1023
BseMII	CTCAG	7 cut(s)	213, 443, 487, 739, 863, 1049, 1128
BseNI	ACTGG	2 cut(s)	1084, 1253
BseRI	GAGGAG	3 cut(s)	434, 437, 1270
BseYI	CCCAGC	2 cut(s)	209, 234
BsgI	GTGCAG	2 cut(s)	608, 629
BshFI	GGCC	5 cut(s)	245, 303, 333, 930, 1265
BslFI	GGGAC	2 cut(s)	217, 1086
BslI	CCNNNNNNNGG	2 cut(s)	241, 914
BsmAI	GTCTC	1 cut(s)	1059
BsmFI	GGGAC	2 cut(s)	217, 1086
BsnI	GGCC	5 cut(s)	245, 303, 333, 930, 1265
Bso31I	GGTCTC	1 cut(s)	1059
Bsp143I	GATC	7 cut(s)	33, 142, 189, 552, 643, 1219, 1275
Bsp1720I	GCTNAGC	2 cut(s)	222, 1137
Bsp19I	CCATGG	1 cut(s)	654
BspACI	CCGC	3 cut(s)	522, 636, 938
BspANI	GGCC	5 cut(s)	245, 303, 333, 930, 1265
BspCNI	CTCAG	7 cut(s)	214, 444, 486, 738, 862, 1048, 1129
BspLI	GGNNCC	3 cut(s)	233, 905, 1102
BspMAI	CTGCAG	2 cut(s)	529, 868
BspPI	GGATC	3 cut(s)	28, 638, 1227
BspTNI	GGTCTC	1 cut(s)	1059
BsrDI	GCAATG	4 cut(s)	678, 766, 827, 1023
BsrI	ACTGG	2 cut(s)	1084, 1253
BssECI	CCNNGG	3 cut(s)	654, 670, 1269
BssMI	GATC	7 cut(s)	33, 142, 189, 552, 643, 1219, 1275
BssT1I	CCWWGG	2 cut(s)	654, 1269
Bst2UI	CCWGG	2 cut(s)	633, 671
Bst4CI	ACNGT	2 cut(s)	1133, 1157
Bst6I	CTCTTC	1 cut(s)	381
BstAPI	GCANNNNNTGC	2 cut(s)	776, 1018
BstC8I	GCNNGC	6 cut(s)	748, 855, 868, 1005, 1014, 1381
BstDEI	CTNAG	7 cut(s)	222, 452, 473, 725, 849, 1035, 1137
BstDSI	CCRYGG	1 cut(s)	654
BstF5I	GGATG	2 cut(s)	433, 973
BstH2I	RGCGCY	1 cut(s)	842
BstHHI	GCGC	1 cut(s)	841
BstKTI	GATC	7 cut(s)	36, 145, 192, 555, 646, 1222, 1278
BstMAI	GTCTC	1 cut(s)	1059
BstMBI	GATC	7 cut(s)	33, 142, 189, 552, 643, 1219, 1275
BstNI	CCWGG	2 cut(s)	633, 671
BstNSI	RCATGY	1 cut(s)	221
BstSCI	CCNGG	2 cut(s)	631, 669
BstSFI	CTRYAG	2 cut(s)	525, 864
BstV2I	GAAGAC	1 cut(s)	21
BstX2I	RGATCY	2 cut(s)	33, 1275
BstXI	CCANNNNNNTGG	2 cut(s)	655, 1097
BstYI	RGATCY	2 cut(s)	33, 1275
BsuRI	GGCC	5 cut(s)	245, 303, 333, 930, 1265
BtgI	CCRYGG	1 cut(s)	654
BtgZI	GCGATG	1 cut(s)	84
BtsCI	GGATG	2 cut(s)	433, 973
BtsI	GCAGTG	2 cut(s)	64, 877
BtsIMutI	CAGTG	5 cut(s)	64, 662, 733, 877, 1138
Cac8I	GCNNGC	6 cut(s)	748, 855, 868, 1005, 1014, 1381
CaiI	CAGNNNCTG	3 cut(s)	361, 896, 1206
CfoI	GCGC	1 cut(s)	841
Cfr13I	GGNCC	5 cut(s)	231, 331, 928, 1100, 1242
CseI	GACGC	1 cut(s)	274
Csp6I	GTAC	1 cut(s)	1074
CviAII	CATG	9 cut(s)	218, 616, 655, 719, 733, 755, 946, 994, 1216
CviQI	GTAC	1 cut(s)	1074
DdeI	CTNAG	7 cut(s)	222, 452, 473, 725, 849, 1035, 1137
DpnI	GATC	7 cut(s)	35, 144, 191, 554, 645, 1221, 1277
DpnII	GATC	7 cut(s)	33, 142, 189, 552, 643, 1219, 1275
Eam1104I	CTCTTC	1 cut(s)	381
EarI	CTCTTC	1 cut(s)	381
Eco130I	CCWWGG	2 cut(s)	654, 1269
Eco31I	GGTCTC	1 cut(s)	1059
Eco32I	GATATC	1 cut(s)	878
Eco47I	GGWCC	3 cut(s)	231, 1100, 1242
Eco47III	AGCGCT	1 cut(s)	840
Eco57I	CTGAAG	3 cut(s)	86, 383, 405
EcoO109I	RGGNCCY	2 cut(s)	331, 1242
EcoRII	CCWGG	2 cut(s)	631, 669
EcoRV	GATATC	1 cut(s)	878
EcoT14I	CCWWGG	2 cut(s)	654, 1269
ErhI	CCWWGG	2 cut(s)	654, 1269
FaeI	CATG	9 cut(s)	221, 619, 658, 722, 736, 758, 949, 997, 1219
FaqI	GGGAC	2 cut(s)	217, 1086
FatI	CATG	9 cut(s)	217, 615, 654, 718, 732, 754, 945, 993, 1215
FauI	CCCGC	1 cut(s)	629
FauNDI	CATATG	2 cut(s)	1179, 1345
FbaI	TGATCA	2 cut(s)	142, 189
FblI	GTMKAC	1 cut(s)	1287
FokI	GGATG	2 cut(s)	440, 960
FspBI	CTAG	5 cut(s)	821, 909, 1071, 1110, 1399
GlaI	GCGC	1 cut(s)	840
GsaI	CCCAGC	2 cut(s)	213, 238
GsuI	CTGGAG	1 cut(s)	918
HaeII	RGCGCY	1 cut(s)	842
HaeIII	GGCC	5 cut(s)	245, 303, 333, 930, 1265
HgaI	GACGC	1 cut(s)	274
HhaI	GCGC	1 cut(s)	841
Hin1II	CATG	9 cut(s)	221, 619, 658, 722, 736, 758, 949, 997, 1219
Hin6I	GCGC	1 cut(s)	839
HinP1I	GCGC	1 cut(s)	839
HincII	GTYRAC	1 cut(s)	1288
HindII	GTYRAC	1 cut(s)	1288
HindIII	AAGCTT	1 cut(s)	23
HinfI	GANTC	1 cut(s)	176
HphI	GGTGA	2 cut(s)	634, 1169
Hpy166II	GTNNAC	4 cut(s)	58, 121, 466, 1288
Hpy188I	TCNGA	6 cut(s)	105, 252, 453, 603, 1038, 1224
Hpy188III	TCNNGA	6 cut(s)	31, 37, 193, 550, 703, 897
Hpy8I	GTNNAC	4 cut(s)	58, 121, 466, 1288
Hpy99I	CGWCG	4 cut(s)	416, 928, 1289, 1292
HpyAV	CCTTC	6 cut(s)	107, 235, 352, 574, 613, 1255
HpyCH4III	ACNGT	2 cut(s)	1133, 1157
HpyF3I	CTNAG	7 cut(s)	222, 452, 473, 725, 849, 1035, 1137
Hsp92II	CATG	9 cut(s)	221, 619, 658, 722, 736, 758, 949, 997, 1219
HspAI	GCGC	1 cut(s)	839
Ksp22I	TGATCA	2 cut(s)	142, 189
Kzo9I	GATC	7 cut(s)	33, 142, 189, 552, 643, 1219, 1275
LweI	GCATC	4 cut(s)	127, 481, 487, 982
MaeI	CTAG	5 cut(s)	821, 909, 1071, 1110, 1399
MaeIII	GTNAC	2 cut(s)	154, 978
MalI	GATC	7 cut(s)	35, 144, 191, 554, 645, 1221, 1277
MboI	GATC	7 cut(s)	33, 142, 189, 552, 643, 1219, 1275
MboII	GAAGA	4 cut(s)	26, 103, 398, 443
MfeI	CAATTG	1 cut(s)	686
MflI	RGATCY	2 cut(s)	33, 1275
MluCI	AATT	8 cut(s)	108, 159, 197, 373, 686, 739, 1144, 1305
MlyI	GAGTC	1 cut(s)	170
MseI	TTAA	2 cut(s)	21, 627
MslI	CAYNNNNRTG	6 cut(s)	69, 620, 759, 950, 998, 1095
MspA1I	CMGCKG	3 cut(s)	361, 524, 1206
MspR9I	CCNGG	2 cut(s)	633, 671
MunI	CAATTG	1 cut(s)	686
MvaI	CCWGG	2 cut(s)	633, 671
NcoI	CCATGG	1 cut(s)	654
NdeI	CATATG	2 cut(s)	1179, 1345
NdeII	GATC	7 cut(s)	33, 142, 189, 552, 643, 1219, 1275
NlaIII	CATG	9 cut(s)	221, 619, 658, 722, 736, 758, 949, 997, 1219
NlaIV	GGNNCC	3 cut(s)	233, 905, 1102
NmuCI	GTSAC	1 cut(s)	978
NspI	RCATGY	1 cut(s)	221
PleI	GAGTC	1 cut(s)	170
PpsI	GAGTC	1 cut(s)	170
PpuMI	RGGWCCY	1 cut(s)	1242
PshBI	ATTAAT	1 cut(s)	627
Psp5II	RGGWCCY	1 cut(s)	1242
Psp6I	CCWGG	2 cut(s)	631, 669
PspFI	CCCAGC	2 cut(s)	209, 234
PspGI	CCWGG	2 cut(s)	631, 669
PspN4I	GGNNCC	3 cut(s)	233, 905, 1102
PspPI	GGNCC	5 cut(s)	231, 331, 928, 1100, 1242
PspPPI	RGGWCCY	1 cut(s)	1242
PstI	CTGCAG	2 cut(s)	529, 868
PstNI	CAGNNNCTG	3 cut(s)	361, 896, 1206
PsuI	RGATCY	2 cut(s)	33, 1275
PvuII	CAGCTG	2 cut(s)	361, 1206
RsaI	GTAC	1 cut(s)	1075
RsaNI	GTAC	1 cut(s)	1074
RseI	CAYNNNNRTG	6 cut(s)	69, 620, 759, 950, 998, 1095
SalI	GTCGAC	1 cut(s)	1286
SaqAI	TTAA	2 cut(s)	21, 627
Sau3AI	GATC	7 cut(s)	33, 142, 189, 552, 643, 1219, 1275
Sau96I	GGNCC	5 cut(s)	231, 331, 928, 1100, 1242
ScaI	AGTACT	1 cut(s)	1075
SchI	GAGTC	1 cut(s)	170
ScrFI	CCNGG	2 cut(s)	633, 671
SfaNI	GCATC	4 cut(s)	127, 481, 487, 982
SfcI	CTRYAG	2 cut(s)	525, 864
SgrDI	CGTCGACG	1 cut(s)	1286
SinI	GGWCC	3 cut(s)	231, 1100, 1242
SmiMI	CAYNNNNRTG	6 cut(s)	69, 620, 759, 950, 998, 1095
SmlI	CTYRAG	3 cut(s)	29, 858, 885
SmoI	CTYRAG	3 cut(s)	29, 858, 885
Sse9I	AATT	8 cut(s)	108, 159, 197, 373, 686, 739, 1144, 1305
SsiI	CCGC	3 cut(s)	522, 636, 938
SspMI	CTAG	5 cut(s)	821, 909, 1071, 1110, 1399
StyD4I	CCNGG	2 cut(s)	631, 669
StyI	CCWWGG	2 cut(s)	654, 1269
TaaI	ACNGT	2 cut(s)	1133, 1157
TaqI	TCGA	1 cut(s)	1287
TasI	AATT	8 cut(s)	108, 159, 197, 373, 686, 739, 1144, 1305
TatI	WGTACW	1 cut(s)	1073
TauI	GCSGC	1 cut(s)	524
Tru1I	TTAA	2 cut(s)	21, 627
Tru9I	TTAA	2 cut(s)	21, 627
TscAI	CASTG	5 cut(s)	71, 669, 733, 877, 1138
TseFI	GTSAC	1 cut(s)	978
Tsp45I	GTSAC	1 cut(s)	978
TspGWI	ACGGA	2 cut(s)	966, 1273
TspRI	CASTG	5 cut(s)	71, 669, 733, 877, 1138
VpaK11BI	GGWCC	3 cut(s)	231, 1100, 1242
VspI	ATTAAT	1 cut(s)	627
XapI	RAATTY	2 cut(s)	739, 1305
XceI	RCATGY	1 cut(s)	221
XcmI	CCANNNNNNNNNTGG	1 cut(s)	739
XmiI	GTMKAC	1 cut(s)	1287
XspI	CTAG	5 cut(s)	821, 909, 1071, 1110, 1399
ZrmI	AGTACT	1 cut(s)	1075

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.