Rmu_sc0000424.1_g000043
ERF Family

heavy metal transport detoxification superfamily protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000424.1
Physical Location & Seq
Forward (+)
184521 .. 186460
1940 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000424.1_g000043.1.cds

Sequence Viewer

Length: 1221 bp
atgactaaagatgaagactttaagcttctcaagatccagacttgtgttctcaaagtgaacatacactgcgatgggtgtaagcagaaagtgaagaaactgcttcagagaattgaaggtgtttaccaagtcagcattgatgctgatcagcagaaagtaacaatttcaggggttatagactctgctactttgatcaagaaattggttagagctgggaaacatgctgagctttggtcccagcagaaggccaatcagaaccaaaaccagaagcaaaagaacaccaactgcgtcaaggacaacaaaggccaaaagcagcagggggggataataaagggccttgaagccttcaaaaaccagcagcagctgaagttccccaatttccttactgaagaggatattgatgacttcttggacgacgatgaggaggaggatgaagatgatgagttgaggtttctgaggcagaaagtgaaccagctcaggcatcaagcgattgatgcaaacaacaatgcaaagaaaggtgttgccgctgcagctaatcccaacaatagtgtcaagatcacaaacaatcacaatgctggaaagaagggagtgcagcacccaaatcagaatgtgcagggcatgaaggtgattaatccaggcgggattgatcccaaaaccatggcagcactgaacctgggaaacattgctcaattgggtggggaagtcaagagggggaataaccatgacctcagtgccatgatgaatttggctggctttcatggcaatggtgctgcaaatgctgctacttctgctgctggtatgggtggcaatcccaatgttagtctagcagcattgcaacaagcgcttcaatctcagcaagctcaagctgcaggcagtggatatcaggctcaagcagcttctggagggttccctagtggtggttatgcgacgggccaatatccgcagaccatgatgatgaacacaaatggctacgggcatccgtcacagatgatgaacatgaatatgcaggcaaggcaagcaatgcagcagcagcaacctcagatgatgtatcataggtctccattcagtcctcctagtactactggttattaccacaactatggtcccactcctagttctgttccatatccatacagtgctgagcctaattacaccaacggtgatggcaacaatgcagctcatatgttcaatgatgagaacaccagcagctgttctatcatgtaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

406

Amino Acids

44.17

Weight (kDa)

8.41

Isoelectric Point (pI)

35.15

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 3 cut(s) 522, 636, 938
AclWI GGATC 2 cut(s) 28, 638
AcsI RAATTY 1 cut(s) 739
AcuI CTGAAG 3 cut(s) 86, 383, 405
AfaI GTAC 1 cut(s) 1075
AfeI AGCGCT 1 cut(s) 840
AfiI CCNNNNNNNGG 2 cut(s) 241, 914
AgsI TTSAA 5 cut(s) 113, 338, 346, 845, 1186
AjnI CCWGG 2 cut(s) 631, 669
Alw26I GTCTC 1 cut(s) 1059
AlwI GGATC 2 cut(s) 28, 638
AlwNI CAGNNNCTG 3 cut(s) 361, 896, 1206
Aor51HI AGCGCT 1 cut(s) 840
AoxI GGCC 4 cut(s) 243, 301, 331, 928
ApoI RAATTY 1 cut(s) 739
AseI ATTAAT 1 cut(s) 627
AspLEI GCGC 1 cut(s) 841
AspS9I GGNCC 4 cut(s) 231, 331, 928, 1100
AsuHPI GGTGA 2 cut(s) 634, 1169
AvaII GGWCC 2 cut(s) 231, 1100
BbsI GAAGAC 1 cut(s) 21
BccI CCATC 2 cut(s) 65, 1154
BciT130I CCWGG 2 cut(s) 633, 671
BclI TGATCA 2 cut(s) 142, 189
BcoDI GTCTC 1 cut(s) 1059
BfaI CTAG 4 cut(s) 821, 909, 1071, 1110
BfmI CTRYAG 2 cut(s) 525, 864
BfoI RGCGCY 1 cut(s) 842
BlpI GCTNAGC 2 cut(s) 222, 1137
BmcAI AGTACT 1 cut(s) 1075
Bme1390I CCNGG 2 cut(s) 633, 671
Bme18I GGWCC 2 cut(s) 231, 1100
BmgT120I GGNCC 4 cut(s) 231, 331, 928, 1100
BmiI GGNNCC 3 cut(s) 233, 905, 1102
BmrFI CCNGG 2 cut(s) 633, 671
BmsI GCATC 4 cut(s) 127, 481, 487, 982
BpiI GAAGAC 1 cut(s) 21
BpmI CTGGAG 1 cut(s) 918
Bpu10I CCTNAGC 1 cut(s) 473
Bpu1102I GCTNAGC 2 cut(s) 222, 1137
BpuEI CTTGAG 3 cut(s) 14, 843, 870
BsaBI GATNNNNATC 1 cut(s) 141
BsaI GGTCTC 1 cut(s) 1059
BsaJI CCNNGG 2 cut(s) 654, 670
Bsc4I CCNNNNNNNGG 2 cut(s) 241, 914
Bse1I ACTGG 1 cut(s) 1084
Bse3DI GCAATG 4 cut(s) 678, 766, 827, 1023
Bse8I GATNNNNATC 1 cut(s) 141
BseBI CCWGG 2 cut(s) 633, 671
BseDI CCNNGG 2 cut(s) 654, 670
BseGI GGATG 2 cut(s) 433, 973
BseJI GATNNNNATC 1 cut(s) 141
BseLI CCNNNNNNNGG 2 cut(s) 241, 914
BseMI GCAATG 4 cut(s) 678, 766, 827, 1023
BseMII CTCAG 7 cut(s) 213, 443, 487, 739, 863, 1049, 1128
BseNI ACTGG 1 cut(s) 1084
BseRI GAGGAG 2 cut(s) 434, 437
BseYI CCCAGC 2 cut(s) 209, 234
BsgI GTGCAG 2 cut(s) 608, 629
BshFI GGCC 4 cut(s) 245, 303, 333, 930
BslFI GGGAC 2 cut(s) 217, 1086
BslI CCNNNNNNNGG 2 cut(s) 241, 914
BsmAI GTCTC 1 cut(s) 1059
BsmFI GGGAC 2 cut(s) 217, 1086
BsnI GGCC 4 cut(s) 245, 303, 333, 930
Bso31I GGTCTC 1 cut(s) 1059
Bsp143I GATC 5 cut(s) 33, 142, 189, 552, 643
Bsp1720I GCTNAGC 2 cut(s) 222, 1137
Bsp19I CCATGG 1 cut(s) 654
BspACI CCGC 3 cut(s) 522, 636, 938
BspANI GGCC 4 cut(s) 245, 303, 333, 930
BspCNI CTCAG 7 cut(s) 214, 444, 486, 738, 862, 1048, 1129
BspLI GGNNCC 3 cut(s) 233, 905, 1102
BspMAI CTGCAG 2 cut(s) 529, 868
BspPI GGATC 2 cut(s) 28, 638
BspTNI GGTCTC 1 cut(s) 1059
BsrDI GCAATG 4 cut(s) 678, 766, 827, 1023
BsrI ACTGG 1 cut(s) 1084
BssECI CCNNGG 2 cut(s) 654, 670
BssMI GATC 5 cut(s) 33, 142, 189, 552, 643
BssT1I CCWWGG 1 cut(s) 654
Bst2UI CCWGG 2 cut(s) 633, 671
Bst4CI ACNGT 2 cut(s) 1133, 1157
Bst6I CTCTTC 1 cut(s) 381
BstAPI GCANNNNNTGC 2 cut(s) 776, 1018
BstC8I GCNNGC 5 cut(s) 748, 855, 868, 1005, 1014
BstDEI CTNAG 7 cut(s) 222, 452, 473, 725, 849, 1035, 1137
BstDSI CCRYGG 1 cut(s) 654
BstF5I GGATG 2 cut(s) 433, 973
BstH2I RGCGCY 1 cut(s) 842
BstHHI GCGC 1 cut(s) 841
BstKTI GATC 5 cut(s) 36, 145, 192, 555, 646
BstMAI GTCTC 1 cut(s) 1059
BstMBI GATC 5 cut(s) 33, 142, 189, 552, 643
BstNI CCWGG 2 cut(s) 633, 671
BstNSI RCATGY 1 cut(s) 221
BstSCI CCNGG 2 cut(s) 631, 669
BstSFI CTRYAG 2 cut(s) 525, 864
BstV2I GAAGAC 1 cut(s) 21
BstX2I RGATCY 1 cut(s) 33
BstXI CCANNNNNNTGG 2 cut(s) 655, 1097
BstYI RGATCY 1 cut(s) 33
BsuRI GGCC 4 cut(s) 245, 303, 333, 930
BtgI CCRYGG 1 cut(s) 654
BtgZI GCGATG 1 cut(s) 84
BtsCI GGATG 2 cut(s) 433, 973
BtsI GCAGTG 2 cut(s) 64, 877
BtsIMutI CAGTG 5 cut(s) 64, 662, 733, 877, 1138
Cac8I GCNNGC 5 cut(s) 748, 855, 868, 1005, 1014
CaiI CAGNNNCTG 3 cut(s) 361, 896, 1206
CfoI GCGC 1 cut(s) 841
Cfr13I GGNCC 4 cut(s) 231, 331, 928, 1100
CseI GACGC 1 cut(s) 274
Csp6I GTAC 1 cut(s) 1074
CviAII CATG 9 cut(s) 218, 616, 655, 719, 733, 755, 946, 994, 1216
CviQI GTAC 1 cut(s) 1074
DdeI CTNAG 7 cut(s) 222, 452, 473, 725, 849, 1035, 1137
DpnI GATC 5 cut(s) 35, 144, 191, 554, 645
DpnII GATC 5 cut(s) 33, 142, 189, 552, 643
Eam1104I CTCTTC 1 cut(s) 381
EarI CTCTTC 1 cut(s) 381
Eco130I CCWWGG 1 cut(s) 654
Eco31I GGTCTC 1 cut(s) 1059
Eco32I GATATC 1 cut(s) 878
Eco47I GGWCC 2 cut(s) 231, 1100
Eco47III AGCGCT 1 cut(s) 840
Eco57I CTGAAG 3 cut(s) 86, 383, 405
EcoO109I RGGNCCY 1 cut(s) 331
EcoRII CCWGG 2 cut(s) 631, 669
EcoRV GATATC 1 cut(s) 878
EcoT14I CCWWGG 1 cut(s) 654
ErhI CCWWGG 1 cut(s) 654
FaeI CATG 9 cut(s) 221, 619, 658, 722, 736, 758, 949, 997, 1219
FaqI GGGAC 2 cut(s) 217, 1086
FatI CATG 9 cut(s) 217, 615, 654, 718, 732, 754, 945, 993, 1215
FauI CCCGC 1 cut(s) 629
FauNDI CATATG 1 cut(s) 1179
FbaI TGATCA 2 cut(s) 142, 189
FokI GGATG 2 cut(s) 440, 960
FspBI CTAG 4 cut(s) 821, 909, 1071, 1110
GlaI GCGC 1 cut(s) 840
GsaI CCCAGC 2 cut(s) 213, 238
GsuI CTGGAG 1 cut(s) 918
HaeII RGCGCY 1 cut(s) 842
HaeIII GGCC 4 cut(s) 245, 303, 333, 930
HgaI GACGC 1 cut(s) 274
HhaI GCGC 1 cut(s) 841
Hin1II CATG 9 cut(s) 221, 619, 658, 722, 736, 758, 949, 997, 1219
Hin6I GCGC 1 cut(s) 839
HinP1I GCGC 1 cut(s) 839
HindIII AAGCTT 1 cut(s) 23
HinfI GANTC 1 cut(s) 176
HphI GGTGA 2 cut(s) 634, 1169
Hpy166II GTNNAC 3 cut(s) 58, 121, 466
Hpy188I TCNGA 5 cut(s) 105, 252, 453, 603, 1038
Hpy188III TCNNGA 6 cut(s) 31, 37, 193, 550, 703, 897
Hpy8I GTNNAC 3 cut(s) 58, 121, 466
Hpy99I CGWCG 2 cut(s) 416, 928
HpyAV CCTTC 5 cut(s) 107, 235, 352, 574, 613
HpyCH4III ACNGT 2 cut(s) 1133, 1157
HpyF3I CTNAG 7 cut(s) 222, 452, 473, 725, 849, 1035, 1137
Hsp92II CATG 9 cut(s) 221, 619, 658, 722, 736, 758, 949, 997, 1219
HspAI GCGC 1 cut(s) 839
Ksp22I TGATCA 2 cut(s) 142, 189
Kzo9I GATC 5 cut(s) 33, 142, 189, 552, 643
LweI GCATC 4 cut(s) 127, 481, 487, 982
MaeI CTAG 4 cut(s) 821, 909, 1071, 1110
MaeIII GTNAC 2 cut(s) 154, 978
MalI GATC 5 cut(s) 35, 144, 191, 554, 645
MboI GATC 5 cut(s) 33, 142, 189, 552, 643
MboII GAAGA 4 cut(s) 26, 103, 398, 443
MfeI CAATTG 1 cut(s) 686
MflI RGATCY 1 cut(s) 33
MluCI AATT 7 cut(s) 108, 159, 197, 373, 686, 739, 1144
MlyI GAGTC 1 cut(s) 170
MseI TTAA 2 cut(s) 21, 627
MslI CAYNNNNRTG 6 cut(s) 69, 620, 759, 950, 998, 1095
MspA1I CMGCKG 3 cut(s) 361, 524, 1206
MspR9I CCNGG 2 cut(s) 633, 671
MunI CAATTG 1 cut(s) 686
MvaI CCWGG 2 cut(s) 633, 671
NcoI CCATGG 1 cut(s) 654
NdeI CATATG 1 cut(s) 1179
NdeII GATC 5 cut(s) 33, 142, 189, 552, 643
NlaIII CATG 9 cut(s) 221, 619, 658, 722, 736, 758, 949, 997, 1219
NlaIV GGNNCC 3 cut(s) 233, 905, 1102
NmuCI GTSAC 1 cut(s) 978
NspI RCATGY 1 cut(s) 221
PleI GAGTC 1 cut(s) 170
PpsI GAGTC 1 cut(s) 170
PshBI ATTAAT 1 cut(s) 627
Psp6I CCWGG 2 cut(s) 631, 669
PspFI CCCAGC 2 cut(s) 209, 234
PspGI CCWGG 2 cut(s) 631, 669
PspN4I GGNNCC 3 cut(s) 233, 905, 1102
PspPI GGNCC 4 cut(s) 231, 331, 928, 1100
PstI CTGCAG 2 cut(s) 529, 868
PstNI CAGNNNCTG 3 cut(s) 361, 896, 1206
PsuI RGATCY 1 cut(s) 33
PvuII CAGCTG 2 cut(s) 361, 1206
RsaI GTAC 1 cut(s) 1075
RsaNI GTAC 1 cut(s) 1074
RseI CAYNNNNRTG 6 cut(s) 69, 620, 759, 950, 998, 1095
SaqAI TTAA 2 cut(s) 21, 627
Sau3AI GATC 5 cut(s) 33, 142, 189, 552, 643
Sau96I GGNCC 4 cut(s) 231, 331, 928, 1100
ScaI AGTACT 1 cut(s) 1075
SchI GAGTC 1 cut(s) 170
ScrFI CCNGG 2 cut(s) 633, 671
SfaNI GCATC 4 cut(s) 127, 481, 487, 982
SfcI CTRYAG 2 cut(s) 525, 864
SinI GGWCC 2 cut(s) 231, 1100
SmiMI CAYNNNNRTG 6 cut(s) 69, 620, 759, 950, 998, 1095
SmlI CTYRAG 3 cut(s) 29, 858, 885
SmoI CTYRAG 3 cut(s) 29, 858, 885
Sse9I AATT 7 cut(s) 108, 159, 197, 373, 686, 739, 1144
SsiI CCGC 3 cut(s) 522, 636, 938
SspMI CTAG 4 cut(s) 821, 909, 1071, 1110
StyD4I CCNGG 2 cut(s) 631, 669
StyI CCWWGG 1 cut(s) 654
TaaI ACNGT 2 cut(s) 1133, 1157
TasI AATT 7 cut(s) 108, 159, 197, 373, 686, 739, 1144
TatI WGTACW 1 cut(s) 1073
TauI GCSGC 1 cut(s) 524
Tru1I TTAA 2 cut(s) 21, 627
Tru9I TTAA 2 cut(s) 21, 627
TscAI CASTG 5 cut(s) 71, 669, 733, 877, 1138
TseFI GTSAC 1 cut(s) 978
Tsp45I GTSAC 1 cut(s) 978
TspDTI ATGAA 8 cut(s) 27, 444, 632, 743, 752, 968, 1004, 1010
TspGWI ACGGA 1 cut(s) 966
TspRI CASTG 5 cut(s) 71, 669, 733, 877, 1138
VpaK11BI GGWCC 2 cut(s) 231, 1100
VspI ATTAAT 1 cut(s) 627
XapI RAATTY 1 cut(s) 739
XceI RCATGY 1 cut(s) 221
XcmI CCANNNNNNNNNTGG 1 cut(s) 739
XspI CTAG 4 cut(s) 821, 909, 1071, 1110
ZrmI AGTACT 1 cut(s) 1075
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.