Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0009497.1

Orthogroup ID

OG0004807

Physical Location & Seq

Genomic Coordinates Forward (+)

25076 .. 25951

Gene Structure 876 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0009497.1_g000005.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 354 bp

ctgaggcaacaagcgattgatgcaaacaaccatgcaaataaaggtattgcggctgcagctaatcccaacagtagtgtcaagatgacaaacaatcacaacgctaggaagaagggagtgcatcacccaaatcagaatgggcagggcatgaaggcgattattaatccaggtgggattgatcccaaaaccatggcagcaatgaacatgagcaacattgctcaattgggtggtggccggaaacatcaatttggaaataaccatgacctcagcgtcatggtgaatttagctggctttcatggcaatggggccgcaaatgctgctatgtctgctgccggttttggtggcaatcccaattaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

HMA

Protein Analysis

117

Amino Acids

12.01

Weight (kDa)

10.71

Isoelectric Point (pI)

26.56

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0004807)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G23000 AT1G23000
fragaria_vesca	FvH4_4g32260
malus_domestica	MD16G1029800.v1.1
prunus_persica	Prupe.1G323100_v2.0.a1 Prupe.3G152200_v2.0.a1
pyrus_communis	pycom05g25530 pycom13g02530 pycom16g02540
rosa_chinensis	RchiOBHm_Chr4g0441051
rosa_laevigata	RLG00000006124 RLG00000010191 RLG00000010192
rosa_multiflora	Rmu_sc0000424.1_g000043 Rmu_sc0002157.1_g000027 Rmu_sc0002157.1_g000028 Rmu_sc0007363.1_g000002 Rmu_sc0009497.1_g000005 Rmu_sc0024852.1_g000001 Rmu_sc0039859.1_g000001
rosa_roxburghii	Rroxscaffold_5G00381970
rosa_rugosa	Rorug03G0304900 Rorug04G0330400
rosa_samantha	Rh2DG461600 Rh4AG008900 Rh4AG382100 Rh4BG395700 Rh4CG410800 Rh4DG388800
rosa_wichuraiana	Rw4G000240 Rw4G032960

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AasI	GACNNNNNNGTC	1 cut(s)	266
AciI	CCGC	2 cut(s)	50, 306
AclWI	GGATC	1 cut(s)	170
AcoI	YGGCCR	1 cut(s)	229
AcsI	RAATTY	1 cut(s)	277
AjnI	CCWGG	1 cut(s)	163
AluBI	AGCT	2 cut(s)	59, 284
AluI	AGCT	2 cut(s)	59, 284
AlwI	GGATC	1 cut(s)	170
AoxI	GGCC	2 cut(s)	229, 303
ApeKI	GCWGC	5 cut(s)	53, 56, 191, 314, 326
ApoI	RAATTY	1 cut(s)	277
AseI	ATTAAT	1 cut(s)	159
AspS9I	GGNCC	1 cut(s)	303
AsuHPI	GGTGA	2 cut(s)	113, 286
BbvCI	CCTCAGC	1 cut(s)	263
BbvI	GCAGC	5 cut(s)	40, 68, 203, 301, 313
BciT130I	CCWGG	1 cut(s)	165
BfaI	CTAG	1 cut(s)	102
BfmI	CTRYAG	1 cut(s)	54
BisI	GCNGC	7 cut(s)	51, 54, 57, 192, 306, 315, 327
BlsI	GCNGC	7 cut(s)	52, 55, 58, 193, 307, 316, 328
Bme1390I	CCNGG	1 cut(s)	165
BmgT120I	GGNCC	1 cut(s)	303
BmiI	GGNNCC	1 cut(s)	304
BmrFI	CCNGG	1 cut(s)	165
BmsI	GCATC	2 cut(s)	10, 127
Bpu10I	CCTNAGC	1 cut(s)	263
BsaJI	CCNNGG	1 cut(s)	186
Bse118I	RCCGGY	1 cut(s)	329
Bse3DI	GCAATG	3 cut(s)	201, 210, 304
BseBI	CCWGG	1 cut(s)	165
BseDI	CCNNGG	1 cut(s)	186
BseMI	GCAATG	3 cut(s)	201, 210, 304
BseMII	CTCAG	1 cut(s)	277
BseXI	GCAGC	5 cut(s)	40, 68, 203, 301, 313
BshFI	GGCC	2 cut(s)	231, 305
BsiSI	CCGG	2 cut(s)	232, 330
BsnI	GGCC	2 cut(s)	231, 305
Bsp143I	GATC	1 cut(s)	175
Bsp19I	CCATGG	1 cut(s)	186
BspACI	CCGC	2 cut(s)	50, 306
BspANI	GGCC	2 cut(s)	231, 305
BspCNI	CTCAG	1 cut(s)	276
BspLI	GGNNCC	1 cut(s)	304
BspMAI	CTGCAG	1 cut(s)	58
BspPI	GGATC	1 cut(s)	170
BsrDI	GCAATG	3 cut(s)	201, 210, 304
BsrFI	RCCGGY	1 cut(s)	329
BssAI	RCCGGY	1 cut(s)	329
BssECI	CCNNGG	1 cut(s)	186
BssMI	GATC	1 cut(s)	175
BssT1I	CCWWGG	1 cut(s)	186
Bst2UI	CCWGG	1 cut(s)	165
Bst4CI	ACNGT	1 cut(s)	71
BstAPI	GCANNNNNTGC	1 cut(s)	314
BstC8I	GCNNGC	1 cut(s)	286
BstDEI	CTNAG	2 cut(s)	2, 263
BstDSI	CCRYGG	1 cut(s)	186
BstKTI	GATC	1 cut(s)	178
BstMBI	GATC	1 cut(s)	175
BstMWI	GCNNNNNNNGC	6 cut(s)	20, 56, 294, 311, 314, 323
BstNI	CCWGG	1 cut(s)	165
BstSCI	CCNGG	1 cut(s)	163
BstSFI	CTRYAG	1 cut(s)	54
BstV1I	GCAGC	5 cut(s)	40, 68, 203, 301, 313
BstXI	CCANNNNNNTGG	1 cut(s)	187
BsuRI	GGCC	2 cut(s)	231, 305
BtgI	CCRYGG	1 cut(s)	186
Cac8I	GCNNGC	1 cut(s)	286
Cfr10I	RCCGGY	1 cut(s)	329
Cfr13I	GGNCC	1 cut(s)	303
CseI	GACGC	1 cut(s)	256
CviAII	CATG	7 cut(s)	32, 145, 187, 202, 257, 271, 293
CviJI	RGCY	6 cut(s)	53, 59, 231, 284, 288, 305
CviKI_1	RGCY	6 cut(s)	53, 59, 231, 284, 288, 305
DdeI	CTNAG	2 cut(s)	2, 263
DpnI	GATC	1 cut(s)	177
DpnII	GATC	1 cut(s)	175
DrdI	GACNNNNNNGTC	1 cut(s)	266
DseDI	GACNNNNNNGTC	1 cut(s)	266
EaeI	YGGCCR	1 cut(s)	229
Eco130I	CCWWGG	1 cut(s)	186
EcoRII	CCWGG	1 cut(s)	163
EcoT14I	CCWWGG	1 cut(s)	186
ErhI	CCWWGG	1 cut(s)	186
FaeI	CATG	7 cut(s)	35, 148, 190, 205, 260, 274, 296
FaiI	YATR	8 cut(s)	33, 146, 188, 203, 258, 272, 294, 320
FatI	CATG	7 cut(s)	31, 144, 186, 201, 256, 270, 292
Fnu4HI	GCNGC	7 cut(s)	51, 54, 57, 192, 306, 315, 327
Fsp4HI	GCNGC	7 cut(s)	51, 54, 57, 192, 306, 315, 327
FspBI	CTAG	1 cut(s)	102
GluI	GCNGC	7 cut(s)	51, 54, 57, 192, 306, 315, 327
HaeIII	GGCC	2 cut(s)	231, 305
HapII	CCGG	2 cut(s)	232, 330
HgaI	GACGC	1 cut(s)	256
Hin1II	CATG	7 cut(s)	35, 148, 190, 205, 260, 274, 296
HpaII	CCGG	2 cut(s)	232, 330
HphI	GGTGA	2 cut(s)	113, 286
Hpy188I	TCNGA	1 cut(s)	132
Hpy188III	TCNNGA	1 cut(s)	79
HpyAV	CCTTC	2 cut(s)	103, 142
HpyCH4III	ACNGT	1 cut(s)	71
HpyCH4V	TGCA	4 cut(s)	23, 35, 56, 118
HpyF10VI	GCNNNNNNNGC	6 cut(s)	20, 56, 294, 311, 314, 323
HpyF3I	CTNAG	2 cut(s)	2, 263
Hsp92II	CATG	7 cut(s)	35, 148, 190, 205, 260, 274, 296
Kzo9I	GATC	1 cut(s)	175
LpnPI	CCDG	6 cut(s)	125, 150, 177, 245, 270, 343
Lsp1109I	GCAGC	5 cut(s)	40, 68, 203, 301, 313
LweI	GCATC	2 cut(s)	10, 127
MaeI	CTAG	1 cut(s)	102
MalI	GATC	1 cut(s)	177
MboI	GATC	1 cut(s)	175
MboII	GAAGA	1 cut(s)	118
MfeI	CAATTG	1 cut(s)	218
MluCI	AATT	4 cut(s)	218, 242, 277, 349
MnlI	CCTC	1 cut(s)	272
MseI	TTAA	2 cut(s)	159, 352
MslI	CAYNNNNRTG	1 cut(s)	297
MspI	CCGG	2 cut(s)	232, 330
MspR9I	CCNGG	1 cut(s)	165
MunI	CAATTG	1 cut(s)	218
MvaI	CCWGG	1 cut(s)	165
MwoI	GCNNNNNNNGC	6 cut(s)	20, 56, 294, 311, 314, 323
NcoI	CCATGG	1 cut(s)	186
NdeII	GATC	1 cut(s)	175
NlaIII	CATG	7 cut(s)	35, 148, 190, 205, 260, 274, 296
NlaIV	GGNNCC	1 cut(s)	304
PkrI	GCNGC	7 cut(s)	52, 55, 58, 193, 307, 316, 328
PshBI	ATTAAT	1 cut(s)	159
Psp6I	CCWGG	1 cut(s)	163
PspGI	CCWGG	1 cut(s)	163
PspN4I	GGNNCC	1 cut(s)	304
PspPI	GGNCC	1 cut(s)	303
PstI	CTGCAG	1 cut(s)	58
RseI	CAYNNNNRTG	1 cut(s)	297
SaqAI	TTAA	2 cut(s)	159, 352
SatI	GCNGC	7 cut(s)	51, 54, 57, 192, 306, 315, 327
Sau3AI	GATC	1 cut(s)	175
Sau96I	GGNCC	1 cut(s)	303
ScrFI	CCNGG	1 cut(s)	165
SetI	ASST	5 cut(s)	46, 61, 169, 264, 286
SfaNI	GCATC	2 cut(s)	10, 127
SfcI	CTRYAG	1 cut(s)	54
SmiMI	CAYNNNNRTG	1 cut(s)	297
Sse9I	AATT	4 cut(s)	218, 242, 277, 349
SsiI	CCGC	2 cut(s)	50, 306
SspMI	CTAG	1 cut(s)	102
StyD4I	CCNGG	1 cut(s)	163
StyI	CCWWGG	1 cut(s)	186
TaaI	ACNGT	1 cut(s)	71
TasI	AATT	4 cut(s)	218, 242, 277, 349
TauI	GCSGC	2 cut(s)	53, 308
Tru1I	TTAA	2 cut(s)	159, 352
Tru9I	TTAA	2 cut(s)	159, 352
TseI	GCWGC	5 cut(s)	53, 56, 191, 314, 326
TspDTI	ATGAA	3 cut(s)	161, 212, 281
VspI	ATTAAT	1 cut(s)	159
XapI	RAATTY	1 cut(s)	277
XspI	CTAG	1 cut(s)	102

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.