Rmu_sc0039859.1_g000001
ERF Family

heavy metal transport detoxification superfamily protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0039859.1
Physical Location & Seq
Forward (+)
1 .. 501
501 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0039859.1_g000001.1.cds

Sequence Viewer

Length: 213 bp
gaggaggatgaagaggatgagttgaggtttctgaggcagaaagtgaaccagctaaggcaacaagcgatcgatgcaaacaacattgcaaagaaaggtgttgtggctgcagcttatcccaacaatagtgtcaagatcacatacaatcacaatgctaggaagaagagaatgcagcacccaaatcagaatgtgcagggcatgaaggcgattatttaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

70

Amino Acids

8.09

Weight (kDa)

9.7

Isoelectric Point (pI)

49.57

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AluBI AGCT 2 cut(s) 52, 110
AluI AGCT 2 cut(s) 52, 110
ApeKI GCWGC 3 cut(s) 104, 107, 169
BbvI GCAGC 3 cut(s) 91, 119, 181
BfaI CTAG 1 cut(s) 153
BfmI CTRYAG 1 cut(s) 105
BisI GCNGC 3 cut(s) 105, 108, 170
BlsI GCNGC 3 cut(s) 106, 109, 171
BmsI GCATC 1 cut(s) 61
Bpu10I CCTNAGC 1 cut(s) 53
Bsa29I ATCGAT 1 cut(s) 69
Bse3DI GCAATG 1 cut(s) 81
BseCI ATCGAT 1 cut(s) 69
BseGI GGATG 2 cut(s) 13, 22
BseMI GCAATG 1 cut(s) 81
BseMII CTCAG 1 cut(s) 23
BseRI GAGGAG 1 cut(s) 17
BseXI GCAGC 3 cut(s) 91, 119, 181
BsgI GTGCAG 1 cut(s) 209
Bsh1285I CGRYCG 1 cut(s) 69
BshVI ATCGAT 1 cut(s) 69
BsiEI CGRYCG 1 cut(s) 69
BsmI GAATGC 1 cut(s) 171
Bsp143I GATC 2 cut(s) 66, 132
BspCNI CTCAG 1 cut(s) 24
BspDI ATCGAT 1 cut(s) 69
BspMAI CTGCAG 1 cut(s) 109
BsrDI GCAATG 1 cut(s) 81
BssMI GATC 2 cut(s) 66, 132
Bst6I CTCTTC 2 cut(s) 6, 155
BstDEI CTNAG 2 cut(s) 32, 53
BstF5I GGATG 2 cut(s) 13, 22
BstKTI GATC 2 cut(s) 69, 135
BstMBI GATC 2 cut(s) 66, 132
BstMCI CGRYCG 1 cut(s) 69
BstMWI GCNNNNNNNGC 1 cut(s) 71
BstSFI CTRYAG 1 cut(s) 105
BstV1I GCAGC 3 cut(s) 91, 119, 181
Bsu15I ATCGAT 1 cut(s) 69
BsuTUI ATCGAT 1 cut(s) 69
BtsCI GGATG 2 cut(s) 13, 22
ClaI ATCGAT 1 cut(s) 69
CviAII CATG 1 cut(s) 196
CviJI RGCY 3 cut(s) 52, 104, 110
CviKI_1 RGCY 3 cut(s) 52, 104, 110
DdeI CTNAG 2 cut(s) 32, 53
DpnI GATC 2 cut(s) 68, 134
DpnII GATC 2 cut(s) 66, 132
Eam1104I CTCTTC 2 cut(s) 6, 155
EarI CTCTTC 2 cut(s) 6, 155
FaeI CATG 1 cut(s) 199
FaiI YATR 2 cut(s) 139, 197
FatI CATG 1 cut(s) 195
Fnu4HI GCNGC 3 cut(s) 105, 108, 170
FokI GGATG 2 cut(s) 20, 29
Fsp4HI GCNGC 3 cut(s) 105, 108, 170
FspBI CTAG 1 cut(s) 153
GluI GCNGC 3 cut(s) 105, 108, 170
Hin1II CATG 1 cut(s) 199
Hpy166II GTNNAC 1 cut(s) 46
Hpy188I TCNGA 2 cut(s) 33, 183
Hpy188III TCNNGA 1 cut(s) 130
Hpy8I GTNNAC 1 cut(s) 46
HpyAV CCTTC 1 cut(s) 193
HpyCH4V TGCA 5 cut(s) 74, 86, 107, 169, 190
HpyF10VI GCNNNNNNNGC 1 cut(s) 71
HpyF3I CTNAG 2 cut(s) 32, 53
Hsp92II CATG 1 cut(s) 199
Kzo9I GATC 2 cut(s) 66, 132
LpnPI CCDG 2 cut(s) 62, 176
Lsp1109I GCAGC 3 cut(s) 91, 119, 181
LweI GCATC 1 cut(s) 61
MaeI CTAG 1 cut(s) 153
MalI GATC 2 cut(s) 68, 134
MboI GATC 2 cut(s) 66, 132
MboII GAAGA 3 cut(s) 23, 169, 172
MnlI CCTC 3 cut(s) 7, 18, 27
MseI TTAA 1 cut(s) 211
Mva1269I GAATGC 1 cut(s) 171
MwoI GCNNNNNNNGC 1 cut(s) 71
NdeII GATC 2 cut(s) 66, 132
NlaIII CATG 1 cut(s) 199
PctI GAATGC 1 cut(s) 171
PkrI GCNGC 3 cut(s) 106, 109, 171
Ple19I CGATCG 1 cut(s) 69
PstI CTGCAG 1 cut(s) 109
PvuI CGATCG 1 cut(s) 69
SaqAI TTAA 1 cut(s) 211
SatI GCNGC 3 cut(s) 105, 108, 170
Sau3AI GATC 2 cut(s) 66, 132
SetI ASST 4 cut(s) 29, 54, 97, 112
SfaNI GCATC 1 cut(s) 61
SfcI CTRYAG 1 cut(s) 105
SgeI CNNG 6 cut(s) 61, 74, 142, 165, 203, 208
SspMI CTAG 1 cut(s) 153
TaqI TCGA 1 cut(s) 69
Tru1I TTAA 1 cut(s) 211
Tru9I TTAA 1 cut(s) 211
TseI GCWGC 3 cut(s) 104, 107, 169
TspDTI ATGAA 2 cut(s) 24, 212
XspI CTAG 1 cut(s) 153
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.