Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0024852.1

Orthogroup ID

OG0004807

Physical Location & Seq

Genomic Coordinates Forward (+)

1 .. 501

Gene Structure 501 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0024852.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 213 bp

gaggaggatgaagaggatgagttgaggtttctgaggcagaaagtgaaccagctcaggcaacatgcgatcgatgcaaacaacattgcaaagaaaggtgttgtggctgcagcttatcccaacaatagtgtcaagatcacatacaatcacaatgctgggaagaagagaatgcagcacccaaatcagaatgtgcagggcatgaaggcgattatttaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

HMA

Protein Analysis

70

Amino Acids

8.0

Weight (kDa)

9.46

Isoelectric Point (pI)

45.61

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0004807)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G23000 AT1G23000
fragaria_vesca	FvH4_4g32260
malus_domestica	MD16G1029800.v1.1
prunus_persica	Prupe.1G323100_v2.0.a1 Prupe.3G152200_v2.0.a1
pyrus_communis	pycom05g25530 pycom13g02530 pycom16g02540
rosa_chinensis	RchiOBHm_Chr4g0441051
rosa_laevigata	RLG00000006124 RLG00000010191 RLG00000010192
rosa_multiflora	Rmu_sc0000424.1_g000043 Rmu_sc0002157.1_g000027 Rmu_sc0002157.1_g000028 Rmu_sc0007363.1_g000002 Rmu_sc0009497.1_g000005 Rmu_sc0024852.1_g000001 Rmu_sc0039859.1_g000001
rosa_roxburghii	Rroxscaffold_5G00381970
rosa_rugosa	Rorug03G0304900 Rorug04G0330400
rosa_samantha	Rh2DG461600 Rh4AG008900 Rh4AG382100 Rh4BG395700 Rh4CG410800 Rh4DG388800
rosa_wichuraiana	Rw4G000240 Rw4G032960

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AluBI	AGCT	2 cut(s)	52, 110
AluI	AGCT	2 cut(s)	52, 110
ApeKI	GCWGC	3 cut(s)	104, 107, 169
BbvI	GCAGC	3 cut(s)	91, 119, 181
BfmI	CTRYAG	1 cut(s)	105
BisI	GCNGC	3 cut(s)	105, 108, 170
BlsI	GCNGC	3 cut(s)	106, 109, 171
BmsI	GCATC	1 cut(s)	61
Bpu10I	CCTNAGC	1 cut(s)	53
Bsa29I	ATCGAT	1 cut(s)	69
Bse3DI	GCAATG	1 cut(s)	81
BseCI	ATCGAT	1 cut(s)	69
BseGI	GGATG	2 cut(s)	13, 22
BseMI	GCAATG	1 cut(s)	81
BseMII	CTCAG	2 cut(s)	23, 67
BseRI	GAGGAG	1 cut(s)	17
BseXI	GCAGC	3 cut(s)	91, 119, 181
BseYI	CCCAGC	1 cut(s)	152
BsgI	GTGCAG	1 cut(s)	209
Bsh1285I	CGRYCG	1 cut(s)	69
BshVI	ATCGAT	1 cut(s)	69
BsiEI	CGRYCG	1 cut(s)	69
BsmI	GAATGC	1 cut(s)	171
Bsp143I	GATC	2 cut(s)	66, 132
BspCNI	CTCAG	2 cut(s)	24, 66
BspDI	ATCGAT	1 cut(s)	69
BspMAI	CTGCAG	1 cut(s)	109
BsrDI	GCAATG	1 cut(s)	81
BssMI	GATC	2 cut(s)	66, 132
Bst6I	CTCTTC	2 cut(s)	6, 155
BstDEI	CTNAG	2 cut(s)	32, 53
BstF5I	GGATG	2 cut(s)	13, 22
BstKTI	GATC	2 cut(s)	69, 135
BstMBI	GATC	2 cut(s)	66, 132
BstMCI	CGRYCG	1 cut(s)	69
BstMWI	GCNNNNNNNGC	1 cut(s)	71
BstNSI	RCATGY	1 cut(s)	65
BstSFI	CTRYAG	1 cut(s)	105
BstV1I	GCAGC	3 cut(s)	91, 119, 181
Bsu15I	ATCGAT	1 cut(s)	69
BsuTUI	ATCGAT	1 cut(s)	69
BtsCI	GGATG	2 cut(s)	13, 22
ClaI	ATCGAT	1 cut(s)	69
CviAII	CATG	2 cut(s)	62, 196
CviJI	RGCY	3 cut(s)	52, 104, 110
CviKI_1	RGCY	3 cut(s)	52, 104, 110
DdeI	CTNAG	2 cut(s)	32, 53
DpnI	GATC	2 cut(s)	68, 134
DpnII	GATC	2 cut(s)	66, 132
Eam1104I	CTCTTC	2 cut(s)	6, 155
EarI	CTCTTC	2 cut(s)	6, 155
FaeI	CATG	2 cut(s)	65, 199
FaiI	YATR	3 cut(s)	63, 139, 197
FatI	CATG	2 cut(s)	61, 195
Fnu4HI	GCNGC	3 cut(s)	105, 108, 170
FokI	GGATG	2 cut(s)	20, 29
Fsp4HI	GCNGC	3 cut(s)	105, 108, 170
GluI	GCNGC	3 cut(s)	105, 108, 170
GsaI	CCCAGC	1 cut(s)	156
Hin1II	CATG	2 cut(s)	65, 199
Hpy166II	GTNNAC	1 cut(s)	46
Hpy188I	TCNGA	2 cut(s)	33, 183
Hpy188III	TCNNGA	1 cut(s)	130
Hpy8I	GTNNAC	1 cut(s)	46
HpyAV	CCTTC	1 cut(s)	193
HpyCH4V	TGCA	5 cut(s)	74, 86, 107, 169, 190
HpyF10VI	GCNNNNNNNGC	1 cut(s)	71
HpyF3I	CTNAG	2 cut(s)	32, 53
Hsp92II	CATG	2 cut(s)	65, 199
Kzo9I	GATC	2 cut(s)	66, 132
LpnPI	CCDG	4 cut(s)	40, 62, 138, 176
Lsp1109I	GCAGC	3 cut(s)	91, 119, 181
LweI	GCATC	1 cut(s)	61
MalI	GATC	2 cut(s)	68, 134
MboI	GATC	2 cut(s)	66, 132
MboII	GAAGA	3 cut(s)	23, 169, 172
MnlI	CCTC	3 cut(s)	7, 18, 27
MseI	TTAA	1 cut(s)	211
Mva1269I	GAATGC	1 cut(s)	171
MwoI	GCNNNNNNNGC	1 cut(s)	71
NdeII	GATC	2 cut(s)	66, 132
NlaIII	CATG	2 cut(s)	65, 199
NspI	RCATGY	1 cut(s)	65
PctI	GAATGC	1 cut(s)	171
PkrI	GCNGC	3 cut(s)	106, 109, 171
Ple19I	CGATCG	1 cut(s)	69
PspFI	CCCAGC	1 cut(s)	152
PstI	CTGCAG	1 cut(s)	109
PvuI	CGATCG	1 cut(s)	69
SaqAI	TTAA	1 cut(s)	211
SatI	GCNGC	3 cut(s)	105, 108, 170
Sau3AI	GATC	2 cut(s)	66, 132
SetI	ASST	4 cut(s)	29, 54, 97, 112
SfaNI	GCATC	1 cut(s)	61
SfcI	CTRYAG	1 cut(s)	105
SgeI	CNNG	7 cut(s)	61, 67, 74, 142, 165, 203, 208
TaqI	TCGA	1 cut(s)	69
Tru1I	TTAA	1 cut(s)	211
Tru9I	TTAA	1 cut(s)	211
TseI	GCWGC	3 cut(s)	104, 107, 169
TspDTI	ATGAA	2 cut(s)	24, 212
XceI	RCATGY	1 cut(s)	65

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.