Rmu_co8020300.1_g000001

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8020300.1
OG0004882
Physical Location & Seq
Reverse (-)
2 .. 392
391 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8020300.1_g000001.1.cds

Sequence Viewer

Length: 391 bp
atgttcaatgtcgataccaagaagtgtcatttaataaagccgcccgttgctcccaaatgggacggacctgttgtatctgcatatgggaaactttactctatcacggttccatactgctcatctgatgtgccagagccctctttcgagcgatatgatccttccaggtgttgttgggaaactcgtaaatcttttccttatggtaaagattggtccaaacgaaggatcgggggtcatgccgtttgtgatggactcatcctgtataatataatctcttctgttggactcattctggaggataatccattctcttgctctagaaaatatcaagatgaactgtgggcttatgatgtaacactggatgaatggcttccagttagggtcgagaacacag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

130

Amino Acids

14.96

Weight (kDa)

6.09

Isoelectric Point (pI)

56.46

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 41
AclWI GGATC 2 cut(s) 149, 230
AfiI CCNNNNNNNGG 1 cut(s) 219
AgsI TTSAA 1 cut(s) 7
AjnI CCWGG 1 cut(s) 161
AlwI GGATC 2 cut(s) 149, 230
Asp700I GAANNNNTTC 1 cut(s) 366
AspS9I GGNCC 2 cut(s) 65, 210
AvaII GGWCC 2 cut(s) 65, 210
BanII GRGCYC 1 cut(s) 138
BccI CCATC 1 cut(s) 239
BceAI ACGGC 1 cut(s) 221
BciT130I CCWGG 1 cut(s) 163
BfaI CTAG 1 cut(s) 315
BisI GCNGC 1 cut(s) 41
BlsI GCNGC 1 cut(s) 42
Bme1390I CCNGG 1 cut(s) 163
Bme18I GGWCC 2 cut(s) 65, 210
BmgT120I GGNCC 2 cut(s) 65, 210
BmiI GGNNCC 1 cut(s) 108
BmrFI CCNGG 1 cut(s) 163
BpmI CTGGAG 1 cut(s) 311
Bsc4I CCNNNNNNNGG 1 cut(s) 219
Bse1I ACTGG 2 cut(s) 360, 371
BseBI CCWGG 1 cut(s) 163
BseGI GGATG 2 cut(s) 252, 364
BseLI CCNNNNNNNGG 1 cut(s) 219
BseNI ACTGG 2 cut(s) 360, 371
BslFI GGGAC 1 cut(s) 74
BslI CCNNNNNNNGG 1 cut(s) 219
BsmFI GGGAC 1 cut(s) 74
Bsp1286I GDGCHC 1 cut(s) 138
Bsp143I GATC 2 cut(s) 154, 222
BspACI CCGC 1 cut(s) 41
BspLI GGNNCC 1 cut(s) 108
BspPI GGATC 2 cut(s) 149, 230
BsrI ACTGG 2 cut(s) 360, 371
BssMI GATC 2 cut(s) 154, 222
Bst2UI CCWGG 1 cut(s) 163
Bst4CI ACNGT 2 cut(s) 106, 336
Bst6I CTCTTC 1 cut(s) 277
BstF5I GGATG 2 cut(s) 252, 364
BstKTI GATC 2 cut(s) 157, 225
BstMBI GATC 2 cut(s) 154, 222
BstNI CCWGG 1 cut(s) 163
BstSCI CCNGG 1 cut(s) 161
BtsCI GGATG 2 cut(s) 252, 364
BtsIMutI CAGTG 1 cut(s) 353
Cfr13I GGNCC 2 cut(s) 65, 210
CviAII CATG 1 cut(s) 233
CviJI RGCY 4 cut(s) 40, 136, 341, 367
CviKI_1 RGCY 4 cut(s) 40, 136, 341, 367
DpnI GATC 2 cut(s) 156, 224
DpnII GATC 2 cut(s) 154, 222
Eam1104I CTCTTC 1 cut(s) 277
EarI CTCTTC 1 cut(s) 277
Eco24I GRGCYC 1 cut(s) 138
Eco47I GGWCC 2 cut(s) 65, 210
EcoRII CCWGG 1 cut(s) 161
EcoT38I GRGCYC 1 cut(s) 138
FaeI CATG 1 cut(s) 236
FaiI YATR 9 cut(s) 82, 84, 112, 153, 198, 234, 261, 266, 345
FaqI GGGAC 1 cut(s) 74
FatI CATG 1 cut(s) 232
FauNDI CATATG 1 cut(s) 82
Fnu4HI GCNGC 1 cut(s) 41
FokI GGATG 2 cut(s) 239, 371
FriOI GRGCYC 1 cut(s) 138
Fsp4HI GCNGC 1 cut(s) 41
FspBI CTAG 1 cut(s) 315
GluI GCNGC 1 cut(s) 41
GsuI CTGGAG 1 cut(s) 311
Hin1II CATG 1 cut(s) 236
HinfI GANTC 2 cut(s) 249, 282
Hpy188I TCNGA 1 cut(s) 124
Hpy188III TCNNGA 4 cut(s) 290, 315, 326, 382
HpyAV CCTTC 2 cut(s) 168, 213
HpyCH4III ACNGT 2 cut(s) 106, 336
HpyCH4V TGCA 1 cut(s) 80
Hsp92II CATG 1 cut(s) 236
Kzo9I GATC 2 cut(s) 154, 222
LmnI GCTCC 1 cut(s) 55
LpnPI CCDG 8 cut(s) 81, 144, 148, 175, 269, 275, 341, 384
MaeI CTAG 1 cut(s) 315
MaeIII GTNAC 1 cut(s) 349
MalI GATC 2 cut(s) 156, 224
MboI GATC 2 cut(s) 154, 222
MboII GAAGA 1 cut(s) 264
MhlI GDGCHC 1 cut(s) 138
MlyI GAGTC 2 cut(s) 243, 276
MmeI TCCRAC 1 cut(s) 259
MnlI CCTC 2 cut(s) 148, 286
MroXI GAANNNNTTC 1 cut(s) 366
MseI TTAA 1 cut(s) 32
MspR9I CCNGG 1 cut(s) 163
MvaI CCWGG 1 cut(s) 163
NdeI CATATG 1 cut(s) 82
NdeII GATC 2 cut(s) 154, 222
NlaIII CATG 1 cut(s) 236
NlaIV GGNNCC 1 cut(s) 108
PdmI GAANNNNTTC 1 cut(s) 366
PkrI GCNGC 1 cut(s) 42
PleI GAGTC 2 cut(s) 243, 276
PpsI GAGTC 2 cut(s) 243, 276
Psp6I CCWGG 1 cut(s) 161
PspGI CCWGG 1 cut(s) 161
PspN4I GGNNCC 1 cut(s) 108
PspPI GGNCC 2 cut(s) 65, 210
SaqAI TTAA 1 cut(s) 32
SatI GCNGC 1 cut(s) 41
Sau3AI GATC 2 cut(s) 154, 222
Sau96I GGNCC 2 cut(s) 65, 210
SchI GAGTC 2 cut(s) 243, 276
ScrFI CCNGG 1 cut(s) 163
SduI GDGCHC 1 cut(s) 138
SetI ASST 2 cut(s) 70, 167
SinI GGWCC 2 cut(s) 65, 210
SsiI CCGC 1 cut(s) 41
SspMI CTAG 1 cut(s) 315
StyD4I CCNGG 1 cut(s) 161
TaaI ACNGT 2 cut(s) 106, 336
TaqI TCGA 3 cut(s) 12, 144, 381
TauI GCSGC 1 cut(s) 43
Tru1I TTAA 1 cut(s) 32
Tru9I TTAA 1 cut(s) 32
TscAI CASTG 1 cut(s) 360
TspDTI ATGAA 2 cut(s) 345, 375
TspGWI ACGGA 1 cut(s) 78
TspRI CASTG 1 cut(s) 360
VpaK11BI GGWCC 2 cut(s) 65, 210
XbaI TCTAGA 1 cut(s) 314
XmnI GAANNNNTTC 1 cut(s) 366
XspI CTAG 1 cut(s) 315
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.