Rmu_co8048568.1_g000001

Protein GAMETE EXPRESSED

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8048568.1
Physical Location & Seq
Forward (+)
1 .. 362
362 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8048568.1_g000001.1.cds

Sequence Viewer

Length: 362 bp
cagtttatgagcaatcaaggaaaatccaagattctcaatctgagctgcaagaaggacaagtagaaatgaagaaaaatttgaaggaaggaatggcaatgttgcaggattcatacagccatttgggacaagaaatcgataacttgaaaaatgaagctgttgaagttgaaaaagagataaccaaagtcggagaccaaatgtcgtctaggatggagaatctgcaggtcaaagcagatgacattaggaatatggcagggctctctttggacaagcaaaagcagcttctagatggacaaacaacagctctcaaggagctcgactttttaaccaaatttcaatccgaggcactagaagagagcaggtaa

Protein Analysis

119

Amino Acids

13.61

Weight (kDa)

4.71

Isoelectric Point (pI)

61.12

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 2 cut(s) 210, 347
AcsI RAATTY 2 cut(s) 75, 328
AgsI TTSAA 5 cut(s) 81, 144, 160, 166, 334
AhdI GACNNNNNGTC 1 cut(s) 195
AluBI AGCT 5 cut(s) 45, 154, 279, 301, 312
AluI AGCT 5 cut(s) 45, 154, 279, 301, 312
Alw21I GWGCWC 1 cut(s) 314
Alw26I GTCTC 1 cut(s) 182
ApeKI GCWGC 2 cut(s) 45, 276
ApoI RAATTY 2 cut(s) 75, 328
BanII GRGCYC 2 cut(s) 257, 314
Bbv12I GWGCWC 1 cut(s) 314
BbvI GCAGC 2 cut(s) 32, 288
BccI CCATC 2 cut(s) 201, 280
BcoDI GTCTC 1 cut(s) 182
BfaI CTAG 3 cut(s) 203, 283, 346
BfmI CTRYAG 1 cut(s) 217
BfuAI ACCTGC 2 cut(s) 210, 347
BisI GCNGC 2 cut(s) 46, 277
BlsI GCNGC 2 cut(s) 47, 278
BmeRI GACNNNNNGTC 1 cut(s) 195
BpuEI CTTGAG 1 cut(s) 289
Bsa29I ATCGAT 1 cut(s) 134
BsaI GGTCTC 1 cut(s) 182
BsaJI CCNNGG 1 cut(s) 338
Bse3DI GCAATG 1 cut(s) 101
BseCI ATCGAT 1 cut(s) 134
BseDI CCNNGG 1 cut(s) 338
BseGI GGATG 1 cut(s) 212
BseMI GCAATG 1 cut(s) 101
BseMII CTCAG 1 cut(s) 32
BseXI GCAGC 2 cut(s) 32, 288
BshVI ATCGAT 1 cut(s) 134
BsiHKAI GWGCWC 1 cut(s) 314
BslFI GGGAC 1 cut(s) 137
BsmAI GTCTC 1 cut(s) 182
BsmFI GGGAC 1 cut(s) 137
Bso31I GGTCTC 1 cut(s) 182
Bsp1286I GDGCHC 2 cut(s) 257, 314
BspCNI CTCAG 1 cut(s) 33
BspDI ATCGAT 1 cut(s) 134
BspMAI CTGCAG 1 cut(s) 221
BspMI ACCTGC 2 cut(s) 210, 347
BspTNI GGTCTC 1 cut(s) 182
BsrDI GCAATG 1 cut(s) 101
BssECI CCNNGG 1 cut(s) 338
Bst6I CTCTTC 1 cut(s) 344
BstDEI CTNAG 1 cut(s) 41
BstF5I GGATG 1 cut(s) 212
BstMAI GTCTC 1 cut(s) 182
BstMWI GCNNNNNNNGC 1 cut(s) 276
BstSFI CTRYAG 1 cut(s) 217
BstV1I GCAGC 2 cut(s) 32, 288
Bsu15I ATCGAT 1 cut(s) 134
BsuTUI ATCGAT 1 cut(s) 134
BtsCI GGATG 1 cut(s) 212
BveI ACCTGC 2 cut(s) 210, 347
ClaI ATCGAT 1 cut(s) 134
CviJI RGCY 7 cut(s) 45, 116, 154, 255, 279, 301, 312
CviKI_1 RGCY 7 cut(s) 45, 116, 154, 255, 279, 301, 312
DdeI CTNAG 1 cut(s) 41
DriI GACNNNNNGTC 1 cut(s) 195
Eam1104I CTCTTC 1 cut(s) 344
Eam1105I GACNNNNNGTC 1 cut(s) 195
EarI CTCTTC 1 cut(s) 344
Ecl136II GAGCTC 1 cut(s) 312
Eco24I GRGCYC 2 cut(s) 257, 314
Eco31I GGTCTC 1 cut(s) 182
Eco53kI GAGCTC 1 cut(s) 312
EcoICRI GAGCTC 1 cut(s) 312
EcoT38I GRGCYC 2 cut(s) 257, 314
FaiI YATR 3 cut(s) 8, 111, 247
FaqI GGGAC 1 cut(s) 137
Fnu4HI GCNGC 2 cut(s) 46, 277
FokI GGATG 1 cut(s) 219
FriOI GRGCYC 2 cut(s) 257, 314
Fsp4HI GCNGC 2 cut(s) 46, 277
FspBI CTAG 3 cut(s) 203, 283, 346
GluI GCNGC 2 cut(s) 46, 277
HinfI GANTC 3 cut(s) 31, 106, 213
Hpy188I TCNGA 3 cut(s) 42, 187, 339
Hpy188III TCNNGA 1 cut(s) 283
HpyAV CCTTC 3 cut(s) 46, 75, 79
HpyCH4V TGCA 3 cut(s) 48, 102, 219
HpyF10VI GCNNNNNNNGC 1 cut(s) 276
HpyF3I CTNAG 1 cut(s) 41
LmnI GCTCC 1 cut(s) 309
LpnPI CCDG 4 cut(s) 88, 205, 236, 342
Lsp1109I GCAGC 2 cut(s) 32, 288
MaeI CTAG 3 cut(s) 203, 283, 346
MboII GAAGA 2 cut(s) 81, 361
MhlI GDGCHC 2 cut(s) 257, 314
MluCI AATT 2 cut(s) 75, 328
MmeI TCCRAC 1 cut(s) 165
MnlI CCTC 1 cut(s) 333
MseI TTAA 1 cut(s) 322
MwoI GCNNNNNNNGC 1 cut(s) 276
PfeI GAWTC 3 cut(s) 31, 106, 213
PkrI GCNGC 2 cut(s) 47, 278
Psp124BI GAGCTC 1 cut(s) 314
PstI CTGCAG 1 cut(s) 221
SacI GAGCTC 1 cut(s) 314
SaqAI TTAA 1 cut(s) 322
SatI GCNGC 2 cut(s) 46, 277
SduI GDGCHC 2 cut(s) 257, 314
SetI ASST 7 cut(s) 47, 156, 224, 281, 303, 314, 361
SfcI CTRYAG 1 cut(s) 217
SmlI CTYRAG 1 cut(s) 304
SmoI CTYRAG 1 cut(s) 304
Sse9I AATT 2 cut(s) 75, 328
SspMI CTAG 3 cut(s) 203, 283, 346
SstI GAGCTC 1 cut(s) 314
TaqI TCGA 2 cut(s) 134, 314
TasI AATT 2 cut(s) 75, 328
TfiI GAWTC 3 cut(s) 31, 106, 213
Tru1I TTAA 1 cut(s) 322
Tru9I TTAA 1 cut(s) 322
TseI GCWGC 2 cut(s) 45, 276
TspDTI ATGAA 3 cut(s) 82, 98, 164
XapI RAATTY 2 cut(s) 75, 328
XbaI TCTAGA 1 cut(s) 282
XspI CTAG 3 cut(s) 203, 283, 346
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.