Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0036082.1

Orthogroup ID

OG0001722

Physical Location & Seq

Genomic Coordinates Reverse (-)

1 .. 437

Gene Structure 437 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0036082.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 426 bp

atgggtcgtcagtgttgttatcttctaattctgctaattctagcattggcttcagcaaagtctcactcatggagttggttcccttcttcagaagagactcaatctactgatgagaactcttctattagtggaacttcagttggcaggttttccatggaaggtcataatgatgaccccaaggcaatcagacttgttgaagatgcagagaagaagttggcaggtccaaactcttgttggcaaaatgcttatcggcatctcttttcggggtgctcggaggtccatgccgttgaagagaagcgctcaagatttgcttggcatctgagtgattgctttcagaaggactctgcaaggcctccttttccttcatgtgacccgaaatctgcaatgtataaatgcttgaaaactttgaacgatgatcagcacaag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000003 GO:0003006 GO:0003674 GO:0005488 GO:0005515 GO:0005575 GO:0005623 GO:0005886 GO:0005887 GO:0007275 GO:0008150 GO:0009553 GO:0009555 GO:0009790 GO:0009791 GO:0009793 GO:0010154 GO:0016020 GO:0016021 GO:0022414 GO:0031224 GO:0031226 GO:0032501 GO:0032502 GO:0042802 GO:0044425 GO:0044459 GO:0044464 GO:0048229 GO:0048316 GO:0048608 GO:0048731 GO:0048856 GO:0061458 GO:0071944

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

142

Amino Acids

16.01

Weight (kDa)

6.58

Isoelectric Point (pI)

58.42

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001722)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G55490 AT5G55490 AT5G55490 AT5G55490 AT5G55490 AT5G55490 AT5G55490 AT5G55490 AT5G55490
fragaria_vesca	FvH4_6g33230 FvH4_6g41730
malus_domestica	MD09G1119800.v1.1 MD09G1266100.v1.1 MD17G1110600.v1.1
prunus_persica	Prupe.3G163900_v2.0.a1 Prupe.3G204300_v2.0.a1 Prupe.3G204300_v2.0.a1
pyrus_communis	pycom07g05510
rosa_chinensis	RchiOBHm_Chr2g0139401 RchiOBHm_Chr2g0142951 RchiOBHm_Chr2g0157531
rosa_laevigata	RLG00000020000 RLG00000020995
rosa_multiflora	Rmu_co8048568.1_g000001 Rmu_sc0000083.1_g000018 Rmu_sc0002277.1_g000037 Rmu_sc0036081.1_g000001 Rmu_sc0036082.1_g000001
rosa_roxburghii	Rroxscaffold_2G00092150 Rroxscaffold_2G00102200 Rroxscaffold_2G00147380
rosa_rugosa	Rorug02G0377400 Rorug02G0461800
rosa_samantha	Rh1CG268300 Rh2AG430400 Rh2AG525900 Rh2BG439400 Rh2BG540600 Rh2CG416100 Rh2CG510600 Rh2DG449400 Rh2DG549100 Rh4BG060600 Rh4CG066400 Rh5DG444200 Rh7DG175700
rosa_wichuraiana	Rw2G035150 Rw2G043560

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc36I	ACCTGC	2 cut(s)	135, 209
AcuI	CTGAAG	3 cut(s)	36, 72, 120
AfeI	AGCGCT	1 cut(s)	299
AgsI	TTSAA	4 cut(s)	197, 290, 400, 409
Alw21I	GWGCWC	1 cut(s)	272
Alw26I	GTCTC	2 cut(s)	66, 89
Aor51HI	AGCGCT	1 cut(s)	299
AoxI	GGCC	1 cut(s)	350
AspLEI	GCGC	1 cut(s)	300
AspS9I	GGNCC	2 cut(s)	221, 277
AvaII	GGWCC	2 cut(s)	221, 277
Bbv12I	GWGCWC	1 cut(s)	272
BceAI	ACGGC	1 cut(s)	269
BclI	TGATCA	1 cut(s)	415
BcoDI	GTCTC	2 cut(s)	66, 89
BfaI	CTAG	1 cut(s)	41
BfoI	RGCGCY	1 cut(s)	301
BfuAI	ACCTGC	2 cut(s)	135, 209
Bme18I	GGWCC	2 cut(s)	221, 277
BmgT120I	GGNCC	2 cut(s)	221, 277
BmiI	GGNNCC	1 cut(s)	80
BmsI	GCATC	3 cut(s)	190, 262, 325
BplI	GAGNNNNNCTC	2 cut(s)	284, 316
BpuEI	CTTGAG	1 cut(s)	286
BsaJI	CCNNGG	2 cut(s)	153, 177
Bse3DI	GCAATG	1 cut(s)	390
BseDI	CCNNGG	2 cut(s)	153, 177
BseMI	GCAATG	1 cut(s)	390
BseMII	CTCAG	1 cut(s)	311
BshFI	GGCC	1 cut(s)	352
BsiHKAI	GWGCWC	1 cut(s)	272
BsmAI	GTCTC	2 cut(s)	66, 89
BsnI	GGCC	1 cut(s)	352
Bsp1286I	GDGCHC	1 cut(s)	272
Bsp143I	GATC	1 cut(s)	415
Bsp19I	CCATGG	1 cut(s)	153
BspANI	GGCC	1 cut(s)	352
BspCNI	CTCAG	1 cut(s)	312
BspLI	GGNNCC	1 cut(s)	80
BspMI	ACCTGC	2 cut(s)	135, 209
BsrDI	GCAATG	1 cut(s)	390
BssECI	CCNNGG	2 cut(s)	153, 177
BssMI	GATC	1 cut(s)	415
BssT1I	CCWWGG	2 cut(s)	153, 177
Bst6I	CTCTTC	3 cut(s)	87, 124, 285
BstDEI	CTNAG	1 cut(s)	320
BstDSI	CCRYGG	1 cut(s)	153
BstH2I	RGCGCY	1 cut(s)	301
BstHHI	GCGC	1 cut(s)	300
BstKTI	GATC	1 cut(s)	418
BstMAI	GTCTC	2 cut(s)	66, 89
BstMBI	GATC	1 cut(s)	415
BsuRI	GGCC	1 cut(s)	352
BtgI	CCRYGG	1 cut(s)	153
BtsIMutI	CAGTG	1 cut(s)	17
BveI	ACCTGC	2 cut(s)	135, 209
CfoI	GCGC	1 cut(s)	300
Cfr13I	GGNCC	2 cut(s)	221, 277
CviAII	CATG	4 cut(s)	69, 154, 281, 366
CviJI	RGCY	2 cut(s)	50, 352
CviKI_1	RGCY	2 cut(s)	50, 352
DdeI	CTNAG	1 cut(s)	320
DpnI	GATC	1 cut(s)	417
DpnII	GATC	1 cut(s)	415
Eam1104I	CTCTTC	3 cut(s)	87, 124, 285
EarI	CTCTTC	3 cut(s)	87, 124, 285
Eco130I	CCWWGG	2 cut(s)	153, 177
Eco147I	AGGCCT	1 cut(s)	352
Eco47I	GGWCC	2 cut(s)	221, 277
Eco47III	AGCGCT	1 cut(s)	299
Eco57I	CTGAAG	3 cut(s)	36, 72, 120
EcoT14I	CCWWGG	2 cut(s)	153, 177
ErhI	CCWWGG	2 cut(s)	153, 177
FaeI	CATG	4 cut(s)	72, 157, 284, 369
FaiI	YATR	6 cut(s)	70, 155, 165, 282, 367, 390
FalI	AAGNNNNNCTT	4 cut(s)	295, 327, 340, 372
FatI	CATG	4 cut(s)	68, 153, 280, 365
FbaI	TGATCA	1 cut(s)	415
FspBI	CTAG	1 cut(s)	41
GlaI	GCGC	1 cut(s)	299
HaeII	RGCGCY	1 cut(s)	301
HaeIII	GGCC	1 cut(s)	352
HhaI	GCGC	1 cut(s)	300
Hin1II	CATG	4 cut(s)	72, 157, 284, 369
Hin6I	GCGC	1 cut(s)	298
HinP1I	GCGC	1 cut(s)	298
HinfI	GANTC	2 cut(s)	97, 341
Hpy188I	TCNGA	5 cut(s)	91, 188, 274, 321, 336
Hpy188III	TCNNGA	1 cut(s)	303
HpyAV	CCTTC	4 cut(s)	93, 152, 331, 372
HpyCH4V	TGCA	3 cut(s)	203, 347, 383
HpyF3I	CTNAG	1 cut(s)	320
Hsp92II	CATG	4 cut(s)	72, 157, 284, 369
HspAI	GCGC	1 cut(s)	298
Ksp22I	TGATCA	1 cut(s)	415
Kzo9I	GATC	1 cut(s)	415
LpnPI	CCDG	2 cut(s)	130, 204
LweI	GCATC	3 cut(s)	190, 262, 325
MaeI	CTAG	1 cut(s)	41
MaeIII	GTNAC	1 cut(s)	368
MalI	GATC	1 cut(s)	417
MboI	GATC	1 cut(s)	415
MboII	GAAGA	7 cut(s)	14, 78, 104, 111, 209, 220, 302
MhlI	GDGCHC	1 cut(s)	272
MluCI	AATT	2 cut(s)	27, 36
MlyI	GAGTC	2 cut(s)	91, 335
MnlI	CCTC	2 cut(s)	268, 363
MslI	CAYNNNNRTG	2 cut(s)	168, 321
NcoI	CCATGG	1 cut(s)	153
NdeII	GATC	1 cut(s)	415
NlaIII	CATG	4 cut(s)	72, 157, 284, 369
NlaIV	GGNNCC	1 cut(s)	80
NmuCI	GTSAC	1 cut(s)	368
PceI	AGGCCT	1 cut(s)	352
PleI	GAGTC	2 cut(s)	91, 335
PpsI	GAGTC	2 cut(s)	91, 335
PspN4I	GGNNCC	1 cut(s)	80
PspPI	GGNCC	2 cut(s)	221, 277
RseI	CAYNNNNRTG	2 cut(s)	168, 321
Sau3AI	GATC	1 cut(s)	415
Sau96I	GGNCC	2 cut(s)	221, 277
SchI	GAGTC	2 cut(s)	91, 335
SduI	GDGCHC	1 cut(s)	272
SetI	ASST	4 cut(s)	149, 163, 223, 279
SfaNI	GCATC	3 cut(s)	190, 262, 325
SinI	GGWCC	2 cut(s)	221, 277
SmiMI	CAYNNNNRTG	2 cut(s)	168, 321
SmlI	CTYRAG	1 cut(s)	301
SmoI	CTYRAG	1 cut(s)	301
Sse9I	AATT	2 cut(s)	27, 36
SseBI	AGGCCT	1 cut(s)	352
SspMI	CTAG	1 cut(s)	41
StuI	AGGCCT	1 cut(s)	352
StyI	CCWWGG	2 cut(s)	153, 177
TasI	AATT	2 cut(s)	27, 36
TscAI	CASTG	1 cut(s)	17
TseFI	GTSAC	1 cut(s)	368
Tsp45I	GTSAC	1 cut(s)	368
TspDTI	ATGAA	1 cut(s)	354
TspRI	CASTG	1 cut(s)	17
VpaK11BI	GGWCC	2 cut(s)	221, 277
XcmI	CCANNNNNNNNNTGG	1 cut(s)	231
XspI	CTAG	1 cut(s)	41

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.