Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8228169.1

Orthogroup ID

OG0003942

Physical Location & Seq

Genomic Coordinates Reverse (-)

1 .. 545

Gene Structure 545 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8228169.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 396 bp

ctgcttgagaggctgactctaattgacctgaatggtattacccatctcaagattgatgcacctaatctccaattccttgaagtccaagatacctttgaggatgttaaggtggagaataccttaaatctggttgatgttttaattgattttggtgaagcttctagctactgtagcaatttgctcaagtattttgttcagctaccacttatggaaaggcttacaatcaagggtttcctttcaaagtgtgctattggttcctcggcagaggagctgcctaaaccatgtcgatgtctgaagttcctttctataggcatacgcttgaataatttggaggagatattagctgctatatgctttctgagaagctcacctgctctacaagaactcaaaatttca

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

F-box FBD LRR_2

Protein Analysis

132

Amino Acids

14.81

Weight (kDa)

4.99

Isoelectric Point (pI)

33.61

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0003942)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_3g25150 FvH4_5g01320 FvH4_5g01330 FvH4_5g09560 FvH4_5g09560 FvH4_5g09560 FvH4_5g09560 FvH4_5g09560 FvH4_5g09560
rosa_chinensis	RchiOBHm_Chr5g0049261 RchiOBHm_Chr7g0188631 RchiOBHm_Chr7g0199601
rosa_laevigata	RLG00000003784 RLG00000004676 RLG00000034607
rosa_multiflora	Rmu_co8228169.1_g000001 Rmu_sc0005358.1_g000008 Rmu_sc0009191.1_g000012 Rmu_sc0018006.1_g000001
rosa_roxburghii	Rroxscaffold_1G00032400 Rroxscaffold_3G00256570 Rroxscaffold_3G00256590 Rroxscaffold_3G00266180
rosa_rugosa	Rorug05G0246700 Rorug06G0491900 Rorug07G0055400
rosa_samantha	Rh5BG334700 Rh5DG346800 Rh7CG099700 Rh7CG189900 Rh7CG190000 Rh7DG098800
rosa_wichuraiana	Rw7G008360 Rw7G015840

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AarI	CACCTGC	1 cut(s)	379
Acc36I	ACCTGC	1 cut(s)	379
AcsI	RAATTY	1 cut(s)	390
AcuI	CTGAAG	1 cut(s)	314
AgsI	TTSAA	3 cut(s)	80, 240, 322
AluBI	AGCT	6 cut(s)	158, 165, 199, 271, 344, 366
AluI	AGCT	6 cut(s)	158, 165, 199, 271, 344, 366
ApeKI	GCWGC	2 cut(s)	271, 344
ApoI	RAATTY	1 cut(s)	390
AsuHPI	GGTGA	2 cut(s)	164, 360
BbvI	GCAGC	2 cut(s)	258, 331
BccI	CCATC	1 cut(s)	51
BfaI	CTAG	1 cut(s)	162
BfmI	CTRYAG	2 cut(s)	169, 306
BfuAI	ACCTGC	1 cut(s)	379
BisI	GCNGC	2 cut(s)	272, 345
BlsI	GCNGC	2 cut(s)	273, 346
BmiI	GGNNCC	1 cut(s)	256
BmsI	GCATC	1 cut(s)	46
BplI	GAGNNNNNCTC	1 cut(s)	33
BpuEI	CTTGAG	3 cut(s)	26, 32, 167
BsaJI	CCNNGG	1 cut(s)	258
BsaXI	ACNNNNNCTCC	2 cut(s)	51, 81
BseDI	CCNNGG	1 cut(s)	258
BseGI	GGATG	1 cut(s)	106
BseMII	CTCAG	1 cut(s)	350
BseRI	GAGGAG	2 cut(s)	281, 347
BseXI	GCAGC	2 cut(s)	258, 331
BspCNI	CTCAG	1 cut(s)	351
BspLI	GGNNCC	1 cut(s)	256
BspMI	ACCTGC	1 cut(s)	379
BssECI	CCNNGG	1 cut(s)	258
Bst4CI	ACNGT	1 cut(s)	170
BstDEI	CTNAG	1 cut(s)	359
BstF5I	GGATG	1 cut(s)	106
BstMWI	GCNNNNNNNGC	2 cut(s)	10, 171
BstSFI	CTRYAG	2 cut(s)	169, 306
BstV1I	GCAGC	2 cut(s)	258, 331
BtsCI	GGATG	1 cut(s)	106
BveI	ACCTGC	1 cut(s)	379
CviAII	CATG	1 cut(s)	282
CviJI	RGCY	8 cut(s)	13, 158, 165, 199, 217, 271, 344, 366
CviKI_1	RGCY	8 cut(s)	13, 158, 165, 199, 217, 271, 344, 366
DdeI	CTNAG	1 cut(s)	359
Eco57I	CTGAAG	1 cut(s)	314
FaeI	CATG	1 cut(s)	285
FaiI	YATR	6 cut(s)	209, 283, 308, 314, 350, 352
FatI	CATG	1 cut(s)	281
Fnu4HI	GCNGC	2 cut(s)	272, 345
FokI	GGATG	1 cut(s)	113
Fsp4HI	GCNGC	2 cut(s)	272, 345
FspBI	CTAG	1 cut(s)	162
GluI	GCNGC	2 cut(s)	272, 345
Hin1II	CATG	1 cut(s)	285
HindIII	AAGCTT	1 cut(s)	156
HinfI	GANTC	1 cut(s)	16
HphI	GGTGA	2 cut(s)	164, 360
Hpy188I	TCNGA	2 cut(s)	294, 360
Hpy188III	TCNNGA	1 cut(s)	49
HpyCH4III	ACNGT	1 cut(s)	170
HpyCH4V	TGCA	1 cut(s)	59
HpyF10VI	GCNNNNNNNGC	2 cut(s)	10, 171
HpyF3I	CTNAG	1 cut(s)	359
Hsp92II	CATG	1 cut(s)	285
LmnI	GCTCC	1 cut(s)	268
LpnPI	CCDG	3 cut(s)	41, 113, 384
Lsp1109I	GCAGC	2 cut(s)	258, 331
LweI	GCATC	1 cut(s)	46
MaeI	CTAG	1 cut(s)	162
MluCI	AATT	6 cut(s)	21, 71, 141, 175, 325, 390
MlyI	GAGTC	1 cut(s)	10
MnlI	CCTC	5 cut(s)	3, 91, 259, 268, 325
MseI	TTAA	3 cut(s)	105, 122, 140
MslI	CAYNNNNRTG	1 cut(s)	286
MwoI	GCNNNNNNNGC	2 cut(s)	10, 171
NlaIII	CATG	1 cut(s)	285
NlaIV	GGNNCC	1 cut(s)	256
NmeAIII	GCCGAG	1 cut(s)	239
PaqCI	CACCTGC	1 cut(s)	379
PkrI	GCNGC	2 cut(s)	273, 346
PleI	GAGTC	1 cut(s)	10
PpsI	GAGTC	1 cut(s)	10
PspN4I	GGNNCC	1 cut(s)	256
RseI	CAYNNNNRTG	1 cut(s)	286
SaqAI	TTAA	3 cut(s)	105, 122, 140
SatI	GCNGC	2 cut(s)	272, 345
SchI	GAGTC	1 cut(s)	10
SfaNI	GCATC	1 cut(s)	46
SfcI	CTRYAG	2 cut(s)	169, 306
SmiMI	CAYNNNNRTG	1 cut(s)	286
SmlI	CTYRAG	3 cut(s)	5, 47, 182
SmoI	CTYRAG	3 cut(s)	5, 47, 182
Sse9I	AATT	6 cut(s)	21, 71, 141, 175, 325, 390
SspMI	CTAG	1 cut(s)	162
TaaI	ACNGT	1 cut(s)	170
TaqI	TCGA	1 cut(s)	286
TasI	AATT	6 cut(s)	21, 71, 141, 175, 325, 390
Tru1I	TTAA	3 cut(s)	105, 122, 140
Tru9I	TTAA	3 cut(s)	105, 122, 140
TseI	GCWGC	2 cut(s)	271, 344
XapI	RAATTY	1 cut(s)	390
XspI	CTAG	1 cut(s)	162

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.