Rmu_co8255059.1_g000001

tRNA (Guanine(26)-N(2))-dimethyltransferase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8255059.1
Physical Location & Seq
Forward (+)
1 .. 334
334 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8255059.1_g000001.1.cds

Sequence Viewer

Length: 240 bp
gcaaattttgctcgagctgttgcgtctcttagcaaggcacagaccaagaaagttgcacggttccttccaaacccggaaaggcattggggtccaaagcttagggcaggtcgtcaaatcaccagcaagcacatttctctcttgggtccagaggctgtcaatgaaattcttaaccaggaagaagatggtgaggaacacaatgccaagcgtcaaaagactgaagataatccgccctcaggttga

Protein Analysis

79

Amino Acids

8.77

Weight (kDa)

9.6

Isoelectric Point (pI)

57.58

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 95
AciI CCGC 1 cut(s) 227
AcsI RAATTY 2 cut(s) 4, 162
AcuI CTGAAG 1 cut(s) 237
AfiI CCNNNNNNNGG 1 cut(s) 233
AjnI CCWGG 1 cut(s) 171
AluBI AGCT 2 cut(s) 17, 97
AluI AGCT 2 cut(s) 17, 97
Alw26I GTCTC 1 cut(s) 30
AlwNI CAGNNNCTG 1 cut(s) 152
Ama87I CYCGRG 1 cut(s) 12
ApoI RAATTY 2 cut(s) 4, 162
AspS9I GGNCC 2 cut(s) 89, 143
AsuC2I CCSGG 1 cut(s) 74
AsuHPI GGTGA 2 cut(s) 109, 197
AvaI CYCGRG 1 cut(s) 12
AvaII GGWCC 2 cut(s) 89, 143
AxyI CCTNAGG 1 cut(s) 232
BccI CCATC 1 cut(s) 176
BciT130I CCWGG 1 cut(s) 173
BcnI CCSGG 1 cut(s) 74
BcoDI GTCTC 1 cut(s) 30
BfuAI ACCTGC 1 cut(s) 95
Bme1390I CCNGG 2 cut(s) 74, 173
Bme18I GGWCC 2 cut(s) 89, 143
BmeT110I CYCGRG 1 cut(s) 12
BmgT120I GGNCC 2 cut(s) 89, 143
BmiI GGNNCC 3 cut(s) 62, 90, 144
BmrFI CCNGG 2 cut(s) 74, 173
Bpu10I CCTNAGC 1 cut(s) 98
BpuMI CCSGG 1 cut(s) 74
Bsc4I CCNNNNNNNGG 1 cut(s) 233
Bse21I CCTNAGG 1 cut(s) 232
BseBI CCWGG 1 cut(s) 173
BseLI CCNNNNNNNGG 1 cut(s) 233
BsiHKCI CYCGRG 1 cut(s) 12
BsiSI CCGG 1 cut(s) 74
BslI CCNNNNNNNGG 1 cut(s) 233
BsmAI GTCTC 1 cut(s) 30
BsmBI CGTCTC 1 cut(s) 30
BsoBI CYCGRG 1 cut(s) 12
BspACI CCGC 1 cut(s) 227
BspLI GGNNCC 3 cut(s) 62, 90, 144
BspMI ACCTGC 1 cut(s) 95
Bst2UI CCWGG 1 cut(s) 173
Bst4CI ACNGT 1 cut(s) 60
BstAPI GCANNNNNTGC 1 cut(s) 8
BstC8I GCNNGC 1 cut(s) 125
BstDEI CTNAG 3 cut(s) 29, 98, 232
BstMAI GTCTC 1 cut(s) 30
BstMWI GCNNNNNNNGC 1 cut(s) 8
BstNI CCWGG 1 cut(s) 173
BstSCI CCNGG 2 cut(s) 72, 171
Bsu36I CCTNAGG 1 cut(s) 232
BveI ACCTGC 1 cut(s) 95
Cac8I GCNNGC 1 cut(s) 125
CaiI CAGNNNCTG 1 cut(s) 152
Cfr13I GGNCC 2 cut(s) 89, 143
CseI GACGC 2 cut(s) 12, 194
CviJI RGCY 3 cut(s) 17, 97, 152
CviKI_1 RGCY 3 cut(s) 17, 97, 152
DdeI CTNAG 3 cut(s) 29, 98, 232
EciI GGCGGA 1 cut(s) 216
Eco47I GGWCC 2 cut(s) 89, 143
Eco57I CTGAAG 1 cut(s) 237
Eco81I CCTNAGG 1 cut(s) 232
Eco88I CYCGRG 1 cut(s) 12
EcoRII CCWGG 1 cut(s) 171
Esp3I CGTCTC 1 cut(s) 30
HapII CCGG 1 cut(s) 74
HgaI GACGC 2 cut(s) 12, 194
HindIII AAGCTT 1 cut(s) 95
HpaII CCGG 1 cut(s) 74
HphI GGTGA 2 cut(s) 109, 197
Hpy188III TCNNGA 1 cut(s) 146
HpyAV CCTTC 1 cut(s) 74
HpyCH4III ACNGT 1 cut(s) 60
HpyCH4V TGCA 1 cut(s) 56
HpyF10VI GCNNNNNNNGC 1 cut(s) 8
HpyF3I CTNAG 3 cut(s) 29, 98, 232
LpnPI CCDG 7 cut(s) 87, 90, 133, 158, 159, 185, 219
MboII GAAGA 3 cut(s) 188, 191, 230
MluCI AATT 2 cut(s) 4, 162
MnlI CCTC 2 cut(s) 142, 181
MseI TTAA 1 cut(s) 168
MspI CCGG 1 cut(s) 74
MspR9I CCNGG 2 cut(s) 74, 173
MvaI CCWGG 1 cut(s) 173
MwoI GCNNNNNNNGC 1 cut(s) 8
NciI CCSGG 1 cut(s) 74
NlaIV GGNNCC 3 cut(s) 62, 90, 144
PaeR7I CTCGAG 1 cut(s) 12
Psp6I CCWGG 1 cut(s) 171
PspGI CCWGG 1 cut(s) 171
PspN4I GGNNCC 3 cut(s) 62, 90, 144
PspPI GGNCC 2 cut(s) 89, 143
PspXI VCTCGAGB 1 cut(s) 12
PstNI CAGNNNCTG 1 cut(s) 152
SaqAI TTAA 1 cut(s) 168
Sau96I GGNCC 2 cut(s) 89, 143
ScrFI CCNGG 2 cut(s) 74, 173
SetI ASST 4 cut(s) 19, 99, 109, 238
Sfr274I CTCGAG 1 cut(s) 12
SinI GGWCC 2 cut(s) 89, 143
SlaI CTCGAG 1 cut(s) 12
SmlI CTYRAG 1 cut(s) 12
SmoI CTYRAG 1 cut(s) 12
Sse9I AATT 2 cut(s) 4, 162
SsiI CCGC 1 cut(s) 227
StyD4I CCNGG 2 cut(s) 72, 171
TaaI ACNGT 1 cut(s) 60
TaqI TCGA 1 cut(s) 13
TasI AATT 2 cut(s) 4, 162
Tru1I TTAA 1 cut(s) 168
Tru9I TTAA 1 cut(s) 168
TspDTI ATGAA 1 cut(s) 174
VpaK11BI GGWCC 2 cut(s) 89, 143
XapI RAATTY 2 cut(s) 4, 162
XcmI CCANNNNNNNNNTGG 1 cut(s) 179
XhoI CTCGAG 1 cut(s) 12
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.