Rh1DG211500

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1D
Physical Location & Seq
Reverse (-)
41153868 .. 41156647
2780 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1DG211500.1

Sequence Viewer

Length: 225 bp
ATGAAGACAGAGCTGAAGGAGAAGCTAGCAAGTAGCAAGAATGCTTGTCTCACCACAACCATCTATTTACCGCTCGCCATCTATGGGCTAGCCTCATCGTCTTCTCACCCTCATGTTGTTGATCGAGGAGGTACGTGGTTGACCTCGTTGAAATGTGGTGGCCTGCAAAACTTGGTCAAGTTTCTCTGTTTAGGAAAATTTTGTTCGAGCTGTTGCGTCTCGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

74

Amino Acids

7.91

Weight (kDa)

9.04

Isoelectric Point (pI)

38.13

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 73
AciI CCGC 1 cut(s) 71
AcsI RAATTY 1 cut(s) 197
AcuI CTGAAG 1 cut(s) 35
AfaI GTAC 1 cut(s) 133
AfiI CCNNNNNNNGG 1 cut(s) 84
AgsI TTSAA 1 cut(s) 151
AluBI AGCT 3 cut(s) 13, 25, 210
AluI AGCT 3 cut(s) 13, 25, 210
Alw26I GTCTC 1 cut(s) 53
AoxI GGCC 1 cut(s) 160
ApoI RAATTY 1 cut(s) 197
AsuHPI GGTGA 2 cut(s) 43, 98
AsuNHI GCTAGC 2 cut(s) 25, 88
BbsI GAAGAC 2 cut(s) 11, 93
BccI CCATC 2 cut(s) 68, 86
BcoDI GTCTC 1 cut(s) 53
BfaI CTAG 2 cut(s) 26, 89
BmtI GCTAGC 2 cut(s) 29, 92
BpiI GAAGAC 2 cut(s) 11, 93
BsaAI YACGTR 1 cut(s) 135
Bsc4I CCNNNNNNNGG 1 cut(s) 84
BseLI CCNNNNNNNGG 1 cut(s) 84
BseRI GAGGAG 1 cut(s) 141
BshFI GGCC 1 cut(s) 162
BslI CCNNNNNNNGG 1 cut(s) 84
BsmAI GTCTC 1 cut(s) 53
BsmI GAATGC 1 cut(s) 46
BsnI GGCC 1 cut(s) 162
Bsp143I GATC 1 cut(s) 121
BspACI CCGC 1 cut(s) 71
BspANI GGCC 1 cut(s) 162
BspOI GCTAGC 2 cut(s) 29, 92
BsrBI CCGCTC 1 cut(s) 73
BssMI GATC 1 cut(s) 121
BstBAI YACGTR 1 cut(s) 135
BstC8I GCNNGC 4 cut(s) 27, 75, 90, 164
BstKTI GATC 1 cut(s) 124
BstMAI GTCTC 1 cut(s) 53
BstMBI GATC 1 cut(s) 121
BstV2I GAAGAC 2 cut(s) 11, 93
BsuRI GGCC 1 cut(s) 162
Cac8I GCNNGC 4 cut(s) 27, 75, 90, 164
CseI GACGC 1 cut(s) 205
Csp6I GTAC 1 cut(s) 132
CviAII CATG 1 cut(s) 113
CviJI RGCY 6 cut(s) 13, 25, 88, 92, 162, 210
CviKI_1 RGCY 6 cut(s) 13, 25, 88, 92, 162, 210
CviQI GTAC 1 cut(s) 132
DpnI GATC 1 cut(s) 123
DpnII GATC 1 cut(s) 121
Eco57I CTGAAG 1 cut(s) 35
FaeI CATG 1 cut(s) 116
FaiI YATR 2 cut(s) 84, 114
FatI CATG 1 cut(s) 112
FspBI CTAG 2 cut(s) 26, 89
HaeIII GGCC 1 cut(s) 162
HgaI GACGC 1 cut(s) 205
Hin1II CATG 1 cut(s) 116
HincII GTYRAC 1 cut(s) 141
HindII GTYRAC 1 cut(s) 141
HphI GGTGA 2 cut(s) 43, 98
Hpy166II GTNNAC 1 cut(s) 141
Hpy8I GTNNAC 1 cut(s) 141
HpyAV CCTTC 1 cut(s) 10
HpyCH4IV ACGT 1 cut(s) 134
HpyCH4V TGCA 1 cut(s) 166
HpySE526I ACGT 1 cut(s) 134
Hsp92II CATG 1 cut(s) 116
Kzo9I GATC 1 cut(s) 121
LpnPI CCDG 1 cut(s) 176
MaeI CTAG 2 cut(s) 26, 89
MaeII ACGT 1 cut(s) 134
MalI GATC 1 cut(s) 123
MbiI CCGCTC 1 cut(s) 73
MboI GATC 1 cut(s) 121
MboII GAAGA 2 cut(s) 16, 93
MluCI AATT 1 cut(s) 197
MnlI CCTC 5 cut(s) 103, 119, 120, 122, 154
MslI CAYNNNNRTG 1 cut(s) 111
Mva1269I GAATGC 1 cut(s) 46
NdeII GATC 1 cut(s) 121
NheI GCTAGC 2 cut(s) 25, 88
NlaIII CATG 1 cut(s) 116
PctI GAATGC 1 cut(s) 46
Ppu21I YACGTR 1 cut(s) 135
RsaI GTAC 1 cut(s) 133
RsaNI GTAC 1 cut(s) 132
RseI CAYNNNNRTG 1 cut(s) 111
Sau3AI GATC 1 cut(s) 121
SetI ASST 6 cut(s) 15, 27, 133, 137, 146, 212
SmiMI CAYNNNNRTG 1 cut(s) 111
Sse9I AATT 1 cut(s) 197
SsiI CCGC 1 cut(s) 71
SspMI CTAG 2 cut(s) 26, 89
TaiI ACGT 1 cut(s) 137
TaqI TCGA 2 cut(s) 124, 206
TasI AATT 1 cut(s) 197
TspDTI ATGAA 1 cut(s) 17
XapI RAATTY 1 cut(s) 197
XspI CTAG 2 cut(s) 26, 89
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.