Rh1AG215300

tRNA (Guanine(26)-N(2))-dimethyltransferase

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1A
Physical Location & Seq
Reverse (-)
41068701 .. 41070162
1462 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1AG215300.1

Sequence Viewer

Length: 246 bp
ATGCTTGAAAATTTTGCTGGAGCTGTTGCGTCTCTTAGCAAGGTACAGAATAAGAAGGTTGCACGCTTCCTTCCAGACCCGGAAATGCATTTAGGTCCAAAGCTTAGGGCAGGTCGTCAAATCACCAGCAAGCACATTTCTCTCTTAGGTCCAGAGGTTGTCAATGAAATTCTTAACCAGGAAGAAGATGGCAGGGAACACAATGCCAAGCGTCAAAGGACTGAAGATAATCCCCCCTCAGGTTGA

Protein Analysis

81

Amino Acids

9.0

Weight (kDa)

8.16

Isoelectric Point (pI)

59.9

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 101
AcsI RAATTY 2 cut(s) 10, 168
AcuI CTGAAG 1 cut(s) 243
AfaI GTAC 1 cut(s) 45
AfiI CCNNNNNNNGG 1 cut(s) 239
AgsI TTSAA 1 cut(s) 8
AjnI CCWGG 1 cut(s) 177
AluBI AGCT 2 cut(s) 23, 103
AluI AGCT 2 cut(s) 23, 103
Alw26I GTCTC 1 cut(s) 36
ApoI RAATTY 2 cut(s) 10, 168
AspS9I GGNCC 2 cut(s) 95, 149
AsuC2I CCSGG 1 cut(s) 80
AsuHPI GGTGA 1 cut(s) 115
AvaII GGWCC 2 cut(s) 95, 149
AxyI CCTNAGG 1 cut(s) 238
BccI CCATC 1 cut(s) 182
BciT130I CCWGG 1 cut(s) 179
BcnI CCSGG 1 cut(s) 80
BcoDI GTCTC 1 cut(s) 36
BfuAI ACCTGC 1 cut(s) 101
Bme1390I CCNGG 2 cut(s) 80, 179
Bme18I GGWCC 2 cut(s) 95, 149
BmgT120I GGNCC 2 cut(s) 95, 149
BmrFI CCNGG 2 cut(s) 80, 179
BpmI CTGGAG 1 cut(s) 39
Bpu10I CCTNAGC 1 cut(s) 104
BpuMI CCSGG 1 cut(s) 80
Bsc4I CCNNNNNNNGG 1 cut(s) 239
Bse21I CCTNAGG 1 cut(s) 238
BseBI CCWGG 1 cut(s) 179
BseLI CCNNNNNNNGG 1 cut(s) 239
BsiSI CCGG 1 cut(s) 80
BslI CCNNNNNNNGG 1 cut(s) 239
BsmAI GTCTC 1 cut(s) 36
BsmBI CGTCTC 1 cut(s) 36
BspMI ACCTGC 1 cut(s) 101
Bst2UI CCWGG 1 cut(s) 179
BstC8I GCNNGC 2 cut(s) 64, 131
BstDEI CTNAG 4 cut(s) 35, 104, 145, 238
BstMAI GTCTC 1 cut(s) 36
BstNI CCWGG 1 cut(s) 179
BstSCI CCNGG 2 cut(s) 78, 177
Bsu36I CCTNAGG 1 cut(s) 238
BveI ACCTGC 1 cut(s) 101
Cac8I GCNNGC 2 cut(s) 64, 131
Cfr13I GGNCC 2 cut(s) 95, 149
CseI GACGC 2 cut(s) 18, 200
Csp6I GTAC 1 cut(s) 44
CviJI RGCY 2 cut(s) 23, 103
CviKI_1 RGCY 2 cut(s) 23, 103
CviQI GTAC 1 cut(s) 44
DdeI CTNAG 4 cut(s) 35, 104, 145, 238
Eco47I GGWCC 2 cut(s) 95, 149
Eco57I CTGAAG 1 cut(s) 243
Eco81I CCTNAGG 1 cut(s) 238
EcoRII CCWGG 1 cut(s) 177
EcoT22I ATGCAT 1 cut(s) 90
Esp3I CGTCTC 1 cut(s) 36
GsuI CTGGAG 1 cut(s) 39
HapII CCGG 1 cut(s) 80
HgaI GACGC 2 cut(s) 18, 200
HindIII AAGCTT 1 cut(s) 101
HpaII CCGG 1 cut(s) 80
HphI GGTGA 1 cut(s) 115
Hpy188III TCNNGA 2 cut(s) 74, 152
HpyAV CCTTC 2 cut(s) 49, 80
HpyCH4V TGCA 2 cut(s) 62, 88
HpyF3I CTNAG 4 cut(s) 35, 104, 145, 238
LmnI GCTCC 1 cut(s) 20
MboII GAAGA 3 cut(s) 194, 197, 236
MluCI AATT 2 cut(s) 10, 168
MnlI CCTC 1 cut(s) 148
Mph1103I ATGCAT 1 cut(s) 90
MseI TTAA 1 cut(s) 174
MspI CCGG 1 cut(s) 80
MspR9I CCNGG 2 cut(s) 80, 179
MvaI CCWGG 1 cut(s) 179
NciI CCSGG 1 cut(s) 80
NsiI ATGCAT 1 cut(s) 90
Psp6I CCWGG 1 cut(s) 177
PspGI CCWGG 1 cut(s) 177
PspPI GGNCC 2 cut(s) 95, 149
RsaI GTAC 1 cut(s) 45
RsaNI GTAC 1 cut(s) 44
SaqAI TTAA 1 cut(s) 174
Sau96I GGNCC 2 cut(s) 95, 149
ScrFI CCNGG 2 cut(s) 80, 179
SetI ASST 9 cut(s) 25, 45, 60, 97, 105, 115, 151, 159, 244
SinI GGWCC 2 cut(s) 95, 149
Sse9I AATT 2 cut(s) 10, 168
StyD4I CCNGG 2 cut(s) 78, 177
TasI AATT 2 cut(s) 10, 168
Tru1I TTAA 1 cut(s) 174
Tru9I TTAA 1 cut(s) 174
TspDTI ATGAA 1 cut(s) 180
VpaK11BI GGWCC 2 cut(s) 95, 149
XapI RAATTY 2 cut(s) 10, 168
XcmI CCANNNNNNNNNTGG 1 cut(s) 185
Zsp2I ATGCAT 1 cut(s) 90
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.