Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8284265.1

Orthogroup ID

OG0002465

Physical Location & Seq

Genomic Coordinates Reverse (-)

1 .. 578

Gene Structure 578 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8284265.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 357 bp

atggaagctctgggatttccttctctgaatactcacaccatttcgtgctctagttttcggcaacgaacacccaccaaattaccatatgaaacaaaccatttctcaagctcttcttcaaaaccaaaaggaccctcttacagaacccaccattttcgtaggagtgctacacgaatgcaagctgacaatgaagatttcgagttgaagcaaatgagagatatggctgctgccaagaaaagatgggatgctctgattagggacggaaaggttaaacctttaacaccaagggaagctgggtatgcaattcagctatctaacaaaacccttcttgatgttcgtccctctacagaacacaaaaag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0009507 GO:0009536 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044424 GO:0044444 GO:0044464

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Rhodanese

Protein Analysis

119

Amino Acids

13.65

Weight (kDa)

10.12

Isoelectric Point (pI)

44.29

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002465)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT4G24750
fragaria_vesca	FvH4_5g06601 FvH4_5g06601
malus_domestica	MD06G1224500.v1.1 MD14G1168400.v1.1 MD14G1168500.v1.1
prunus_persica	Prupe.5G163400_v2.0.a1
pyrus_communis	pycom06g14590 pycom14g14040
rosa_chinensis	RchiOBHm_Chr1g0313851 RchiOBHm_Chr2g0119491 RchiOBHm_Chr3g0475211 RchiOBHm_Chr7g0192141
rosa_laevigata	RLG00000004393
rosa_multiflora	Rmu_co8284265.1_g000001 Rmu_sc0000532.1_g000033 Rmu_sc0002164.1_g000021 Rmu_ssc0000421.1_g000056
rosa_roxburghii	Rroxscaffold_3G00263270 Rroxscaffold_5G00338510
rosa_rugosa	Rorug02G0315800
rosa_samantha	Rh1CG190600 Rh2CG296500 Rh2CG301500 Rh2DG305300 Rh2DG333600 Rh3AG197200 Rh3CG297700 Rh4BG186600 Rh4BG221800 Rh5CG365300 Rh6AG223100 Rh6CG220800 Rh7AG123500 Rh7BG125200 Rh7CG127900 Rh7DG127100
rosa_wichuraiana	Rw2G005530 Rw3G015860 Rw3G028470 Rw7G010550

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AgsI	TTSAA	2 cut(s)	117, 202
AluBI	AGCT	5 cut(s)	8, 108, 179, 290, 307
AluI	AGCT	5 cut(s)	8, 108, 179, 290, 307
Alw21I	GWGCWC	1 cut(s)	50
ApeKI	GCWGC	2 cut(s)	221, 224
AspS9I	GGNCC	1 cut(s)	128
AvaII	GGWCC	1 cut(s)	128
Bbv12I	GWGCWC	1 cut(s)	50
BbvI	GCAGC	2 cut(s)	208, 211
BccI	CCATC	1 cut(s)	231
BfaI	CTAG	1 cut(s)	51
BfmI	CTRYAG	1 cut(s)	342
BisI	GCNGC	2 cut(s)	222, 225
BlsI	GCNGC	2 cut(s)	223, 226
Bme18I	GGWCC	1 cut(s)	128
BmgT120I	GGNCC	1 cut(s)	128
BmiI	GGNNCC	1 cut(s)	130
BmsI	GCATC	1 cut(s)	232
BpuEI	CTTGAG	1 cut(s)	88
BsaJI	CCNNGG	1 cut(s)	281
BseDI	CCNNGG	1 cut(s)	281
BseGI	GGATG	1 cut(s)	247
BseXI	GCAGC	2 cut(s)	208, 211
BseYI	CCCAGC	1 cut(s)	290
BsiHKAI	GWGCWC	1 cut(s)	50
BslFI	GGGAC	2 cut(s)	269, 321
BsmFI	GGGAC	2 cut(s)	269, 321
BsmI	GAATGC	1 cut(s)	177
Bsp1286I	GDGCHC	1 cut(s)	50
BspLI	GGNNCC	1 cut(s)	130
BspQI	GCTCTTC	1 cut(s)	115
BssECI	CCNNGG	1 cut(s)	281
BssT1I	CCWWGG	1 cut(s)	281
Bst6I	CTCTTC	1 cut(s)	115
BstC8I	GCNNGC	1 cut(s)	177
BstF5I	GGATG	1 cut(s)	247
BstMWI	GCNNNNNNNGC	1 cut(s)	296
BstSFI	CTRYAG	1 cut(s)	342
BstV1I	GCAGC	2 cut(s)	208, 211
BtsCI	GGATG	1 cut(s)	247
Cac8I	GCNNGC	1 cut(s)	177
Cfr13I	GGNCC	1 cut(s)	128
CviJI	RGCY	6 cut(s)	8, 108, 179, 221, 290, 307
CviKI_1	RGCY	6 cut(s)	8, 108, 179, 221, 290, 307
Eam1104I	CTCTTC	1 cut(s)	115
EarI	CTCTTC	1 cut(s)	115
Eco130I	CCWWGG	1 cut(s)	281
Eco47I	GGWCC	1 cut(s)	128
EcoO109I	RGGNCCY	1 cut(s)	128
EcoT14I	CCWWGG	1 cut(s)	281
ErhI	CCWWGG	1 cut(s)	281
FaiI	YATR	4 cut(s)	85, 87, 218, 297
FalI	AAGNNNNNCTT	2 cut(s)	97, 129
FaqI	GGGAC	2 cut(s)	269, 321
FauNDI	CATATG	1 cut(s)	85
Fnu4HI	GCNGC	2 cut(s)	222, 225
FokI	GGATG	1 cut(s)	254
Fsp4HI	GCNGC	2 cut(s)	222, 225
FspBI	CTAG	1 cut(s)	51
GluI	GCNGC	2 cut(s)	222, 225
GsaI	CCCAGC	1 cut(s)	294
Hpy188I	TCNGA	2 cut(s)	27, 249
Hpy188III	TCNNGA	1 cut(s)	326
HpyAV	CCTTC	2 cut(s)	30, 332
HpyCH4V	TGCA	2 cut(s)	175, 299
HpyF10VI	GCNNNNNNNGC	1 cut(s)	296
LguI	GCTCTTC	1 cut(s)	115
LpnPI	CCDG	1 cut(s)	276
Lsp1109I	GCAGC	2 cut(s)	208, 211
LweI	GCATC	1 cut(s)	232
MaeI	CTAG	1 cut(s)	51
MboII	GAAGA	3 cut(s)	102, 105, 200
MhlI	GDGCHC	1 cut(s)	50
MluCI	AATT	2 cut(s)	77, 300
MnlI	CCTC	2 cut(s)	142, 349
MseI	TTAA	2 cut(s)	267, 275
Mva1269I	GAATGC	1 cut(s)	177
MwoI	GCNNNNNNNGC	1 cut(s)	296
NdeI	CATATG	1 cut(s)	85
NlaIV	GGNNCC	1 cut(s)	130
PciSI	GCTCTTC	1 cut(s)	115
PctI	GAATGC	1 cut(s)	177
PkrI	GCNGC	2 cut(s)	223, 226
PpuMI	RGGWCCY	1 cut(s)	128
Psp5II	RGGWCCY	1 cut(s)	128
PspFI	CCCAGC	1 cut(s)	290
PspN4I	GGNNCC	1 cut(s)	130
PspPI	GGNCC	1 cut(s)	128
PspPPI	RGGWCCY	1 cut(s)	128
SapI	GCTCTTC	1 cut(s)	115
SaqAI	TTAA	2 cut(s)	267, 275
SatI	GCNGC	2 cut(s)	222, 225
Sau96I	GGNCC	1 cut(s)	128
SduI	GDGCHC	1 cut(s)	50
SetI	ASST	7 cut(s)	10, 110, 181, 267, 274, 292, 309
SfaNI	GCATC	1 cut(s)	232
SfcI	CTRYAG	1 cut(s)	342
SinI	GGWCC	1 cut(s)	128
SmlI	CTYRAG	1 cut(s)	103
SmoI	CTYRAG	1 cut(s)	103
Sse9I	AATT	2 cut(s)	77, 300
SspMI	CTAG	1 cut(s)	51
StyI	CCWWGG	1 cut(s)	281
TaqI	TCGA	1 cut(s)	195
TasI	AATT	2 cut(s)	77, 300
Tru1I	TTAA	2 cut(s)	267, 275
Tru9I	TTAA	2 cut(s)	267, 275
TseI	GCWGC	2 cut(s)	221, 224
TspDTI	ATGAA	2 cut(s)	102, 201
TspGWI	ACGGA	1 cut(s)	273
VpaK11BI	GGWCC	1 cut(s)	128
XspI	CTAG	1 cut(s)	51

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.