Rh1CG190600

Rhodanese-like domain-containing protein 11

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1C
Physical Location & Seq
Forward (+)
41436745 .. 41439261
2517 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1CG190600.1

Sequence Viewer

Length: 408 bp
ATGTTAATTTGTCCCTCTATAGAACACAAAAAGGCATGGGTCAAAGGCTCAACCTGGATTCCAATATTTGATGTTGGTGACGAATTCGATGTTGGAACTCTTTATAGAAAGATTATGGGATTCACTATGGGGGGTTGGTGGAGTGGTGTGCCTACATTGGCGTATAACAACATTATTCCAAAAGGAGTGTGGAAAACCAAAATTGCAAAGAAGCTAAGCAAAATGCTGGTGAATCATCTGGGGCTAACATTGACTAAAGAAGACCTGCAAAGTGTGGTTGATCTAATGGAGCCATATGGTCAGATAAGCAATGGAATAGAACTTCTAAACCCTCCTCTTGAGTCTACTACTTTAAGCATGGGGAATAACCATGAGTATGATATGGCAGTTAAAGTTGAAAAGGTATGA
Functional Annotation
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

135

Amino Acids

15.14

Weight (kDa)

6.83

Isoelectric Point (pI)

30.82

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 273
AccI GTMKAC 1 cut(s) 344
AcsI RAATTY 1 cut(s) 83
AgsI TTSAA 1 cut(s) 398
AjnI CCWGG 1 cut(s) 53
AjuI GAANNNNNNNTTGG 2 cut(s) 75, 107
AluBI AGCT 1 cut(s) 214
AluI AGCT 1 cut(s) 214
ApoI RAATTY 1 cut(s) 83
AsuHPI GGTGA 2 cut(s) 89, 241
BbsI GAAGAC 1 cut(s) 267
BciT130I CCWGG 1 cut(s) 55
BfmI CTRYAG 1 cut(s) 18
BfuAI ACCTGC 1 cut(s) 273
BlpI GCTNAGC 1 cut(s) 215
Bme1390I CCNGG 1 cut(s) 55
BmiI GGNNCC 1 cut(s) 291
BmrFI CCNGG 1 cut(s) 55
BpiI GAAGAC 1 cut(s) 267
Bpu1102I GCTNAGC 1 cut(s) 215
BpuEI CTTGAG 1 cut(s) 359
Bse3DI GCAATG 1 cut(s) 316
BseBI CCWGG 1 cut(s) 55
BseMI GCAATG 1 cut(s) 316
BseRI GAGGAG 1 cut(s) 324
Bsp143I GATC 1 cut(s) 280
Bsp1720I GCTNAGC 1 cut(s) 215
BspLI GGNNCC 1 cut(s) 291
BspMI ACCTGC 1 cut(s) 273
BsrDI GCAATG 1 cut(s) 316
BssMI GATC 1 cut(s) 280
Bst2UI CCWGG 1 cut(s) 55
BstDEI CTNAG 1 cut(s) 215
BstKTI GATC 1 cut(s) 283
BstMBI GATC 1 cut(s) 280
BstNI CCWGG 1 cut(s) 55
BstSCI CCNGG 1 cut(s) 53
BstSFI CTRYAG 1 cut(s) 18
BstV2I GAAGAC 1 cut(s) 267
BveI ACCTGC 1 cut(s) 273
CviAII CATG 3 cut(s) 36, 358, 371
CviJI RGCY 4 cut(s) 48, 214, 244, 292
CviKI_1 RGCY 4 cut(s) 48, 214, 244, 292
DdeI CTNAG 1 cut(s) 215
DpnI GATC 1 cut(s) 282
DpnII GATC 1 cut(s) 280
EcoRI GAATTC 1 cut(s) 83
EcoRII CCWGG 1 cut(s) 53
FaeI CATG 3 cut(s) 39, 361, 374
FatI CATG 3 cut(s) 35, 357, 370
FauNDI CATATG 1 cut(s) 295
FblI GTMKAC 1 cut(s) 344
Hin1II CATG 3 cut(s) 39, 361, 374
HinfI GANTC 4 cut(s) 58, 120, 232, 341
HphI GGTGA 2 cut(s) 89, 241
Hpy166II GTNNAC 1 cut(s) 345
Hpy188I TCNGA 1 cut(s) 303
Hpy188III TCNNGA 1 cut(s) 338
Hpy8I GTNNAC 1 cut(s) 345
HpyCH4V TGCA 2 cut(s) 206, 268
HpyF3I CTNAG 1 cut(s) 215
Hsp92II CATG 3 cut(s) 39, 361, 374
Kzo9I GATC 1 cut(s) 280
LmnI GCTCC 1 cut(s) 289
LpnPI CCDG 5 cut(s) 40, 67, 212, 224, 278
MaeIII GTNAC 1 cut(s) 77
MalI GATC 1 cut(s) 282
MboI GATC 1 cut(s) 280
MboII GAAGA 1 cut(s) 272
MluCI AATT 3 cut(s) 6, 83, 201
MlyI GAGTC 1 cut(s) 350
MmeI TCCRAC 1 cut(s) 73
MnlI CCTC 3 cut(s) 25, 342, 345
MseI TTAA 3 cut(s) 5, 353, 390
MslI CAYNNNNRTG 1 cut(s) 375
MspR9I CCNGG 1 cut(s) 55
MvaI CCWGG 1 cut(s) 55
NdeI CATATG 1 cut(s) 295
NdeII GATC 1 cut(s) 280
NlaIII CATG 3 cut(s) 39, 361, 374
NlaIV GGNNCC 1 cut(s) 291
NmuCI GTSAC 1 cut(s) 77
PfeI GAWTC 3 cut(s) 58, 120, 232
PleI GAGTC 1 cut(s) 349
PpsI GAGTC 1 cut(s) 349
Psp6I CCWGG 1 cut(s) 53
PspGI CCWGG 1 cut(s) 53
PspN4I GGNNCC 1 cut(s) 291
RseI CAYNNNNRTG 1 cut(s) 375
SaqAI TTAA 3 cut(s) 5, 353, 390
Sau3AI GATC 1 cut(s) 280
SchI GAGTC 1 cut(s) 350
ScrFI CCNGG 1 cut(s) 55
SetI ASST 4 cut(s) 56, 216, 267, 405
SfcI CTRYAG 1 cut(s) 18
SgeI CNNG 9 cut(s) 48, 66, 67, 239, 251, 277, 350, 370, 383
SmiMI CAYNNNNRTG 1 cut(s) 375
SmlI CTYRAG 1 cut(s) 338
SmoI CTYRAG 1 cut(s) 338
Sse9I AATT 3 cut(s) 6, 83, 201
SspI AATATT 1 cut(s) 66
StyD4I CCNGG 1 cut(s) 53
TaqI TCGA 1 cut(s) 87
TasI AATT 3 cut(s) 6, 83, 201
TfiI GAWTC 3 cut(s) 58, 120, 232
Tru1I TTAA 3 cut(s) 5, 353, 390
Tru9I TTAA 3 cut(s) 5, 353, 390
TseFI GTSAC 1 cut(s) 77
Tsp45I GTSAC 1 cut(s) 77
XapI RAATTY 1 cut(s) 83
XcmI CCANNNNNNNNNTGG 1 cut(s) 186
XmiI GTMKAC 1 cut(s) 344
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.