Rw2G005530

Rhodanese-like domain-containing protein 11

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr2
Physical Location & Seq
Forward (+)
5211288 .. 5213809
2522 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw2G005530.1

Sequence Viewer

Length: 438 bp
ATGCAAGCTGACAATGAAGATTTCGAGTTGAAGCAAATGAGAGATATGGCTGCTACCAAAAAAAGATGGGATGCTCTGATTAGGGACAGAAAGATTAAACCTTTAACACCAACGGAAGCTGGGTATGCAATTCAACTATCTAACAAAACCCTTCTTGATGCATGGGTCAAAGGCTCAACCTGGATTCCAATATTTGATGTTGGTGACAAATTCGATGTTGGAACTCTTTATAAAAAGATTATGGGATTCACTATGGGGGGTTGGTGGAGTGGTGTGCCTACATTGGCGTATAACAACCAGTTGTCAAAGGTTGATCATAAATTTCCAAAGCATACCAATCTTATCGTTGCATGCCAGAAGGGATTGAGATCTATAGCTGCTTGTGAGGTGCTGTACAATGCTGGCTACAGAAACCCCTTCTGGGTTCAGGGGGTCTAG
Functional Annotation
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

145

Amino Acids

16.5

Weight (kDa)

9.37

Isoelectric Point (pI)

25.84

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 231
AcsI RAATTY 2 cut(s) 209, 320
AfaI GTAC 1 cut(s) 395
AfiI CCNNNNNNNGG 1 cut(s) 421
AgsI TTSAA 2 cut(s) 31, 134
AjnI CCWGG 1 cut(s) 179
AluBI AGCT 3 cut(s) 8, 119, 377
AluI AGCT 3 cut(s) 8, 119, 377
ApeKI GCWGC 2 cut(s) 50, 377
ApoI RAATTY 2 cut(s) 209, 320
AsuHPI GGTGA 1 cut(s) 215
BbvI GCAGC 2 cut(s) 37, 364
BccI CCATC 1 cut(s) 60
BciT130I CCWGG 1 cut(s) 181
BclI TGATCA 1 cut(s) 313
BfaI CTAG 1 cut(s) 436
BfmI CTRYAG 2 cut(s) 372, 406
BglII AGATCT 1 cut(s) 368
BisI GCNGC 2 cut(s) 51, 378
BlsI GCNGC 2 cut(s) 52, 379
Bme1390I CCNGG 1 cut(s) 181
BmrFI CCNGG 1 cut(s) 181
BmsI GCATC 2 cut(s) 61, 148
BsaBI GATNNNNATC 1 cut(s) 367
Bsc4I CCNNNNNNNGG 1 cut(s) 421
Bse1I ACTGG 1 cut(s) 298
Bse8I GATNNNNATC 1 cut(s) 367
BseBI CCWGG 1 cut(s) 181
BseGI GGATG 1 cut(s) 76
BseJI GATNNNNATC 1 cut(s) 367
BseLI CCNNNNNNNGG 1 cut(s) 421
BseNI ACTGG 1 cut(s) 298
BseXI GCAGC 2 cut(s) 37, 364
BseYI CCCAGC 1 cut(s) 119
BslFI GGGAC 1 cut(s) 98
BslI CCNNNNNNNGG 1 cut(s) 421
BsmFI GGGAC 1 cut(s) 98
Bsp1407I TGTACA 1 cut(s) 393
Bsp143I GATC 2 cut(s) 313, 368
BsrGI TGTACA 1 cut(s) 393
BsrI ACTGG 1 cut(s) 298
BssMI GATC 2 cut(s) 313, 368
Bst2UI CCWGG 1 cut(s) 181
BstAUI TGTACA 1 cut(s) 393
BstC8I GCNNGC 3 cut(s) 6, 352, 403
BstF5I GGATG 1 cut(s) 76
BstKTI GATC 2 cut(s) 316, 371
BstMBI GATC 2 cut(s) 313, 368
BstMWI GCNNNNNNNGC 1 cut(s) 125
BstNI CCWGG 1 cut(s) 181
BstNSI RCATGY 1 cut(s) 354
BstSCI CCNGG 1 cut(s) 179
BstSFI CTRYAG 2 cut(s) 372, 406
BstV1I GCAGC 2 cut(s) 37, 364
BstX2I RGATCY 1 cut(s) 368
BstYI RGATCY 1 cut(s) 368
BtsCI GGATG 1 cut(s) 76
Cac8I GCNNGC 3 cut(s) 6, 352, 403
Csp6I GTAC 1 cut(s) 394
CviAII CATG 2 cut(s) 162, 351
CviJI RGCY 6 cut(s) 8, 50, 119, 174, 377, 405
CviKI_1 RGCY 6 cut(s) 8, 50, 119, 174, 377, 405
CviQI GTAC 1 cut(s) 394
DpnI GATC 2 cut(s) 315, 370
DpnII GATC 2 cut(s) 313, 368
EcoRII CCWGG 1 cut(s) 179
EcoT22I ATGCAT 1 cut(s) 163
FaeI CATG 2 cut(s) 165, 354
FaqI GGGAC 1 cut(s) 98
FatI CATG 2 cut(s) 161, 350
FbaI TGATCA 1 cut(s) 313
Fnu4HI GCNGC 2 cut(s) 51, 378
FokI GGATG 1 cut(s) 83
Fsp4HI GCNGC 2 cut(s) 51, 378
FspBI CTAG 1 cut(s) 436
GluI GCNGC 2 cut(s) 51, 378
GsaI CCCAGC 1 cut(s) 123
Hin1II CATG 2 cut(s) 165, 354
HinfI GANTC 2 cut(s) 184, 246
HphI GGTGA 1 cut(s) 215
Hpy188I TCNGA 1 cut(s) 78
Hpy188III TCNNGA 1 cut(s) 155
HpyAV CCTTC 3 cut(s) 161, 352, 427
HpyCH4V TGCA 4 cut(s) 4, 128, 161, 350
HpyF10VI GCNNNNNNNGC 1 cut(s) 125
Hsp92II CATG 2 cut(s) 165, 354
Ksp22I TGATCA 1 cut(s) 313
Kzo9I GATC 2 cut(s) 313, 368
LpnPI CCDG 8 cut(s) 105, 166, 193, 311, 368, 387, 406, 413
Lsp1109I GCAGC 2 cut(s) 37, 364
LweI GCATC 2 cut(s) 61, 148
MaeI CTAG 1 cut(s) 436
MaeIII GTNAC 1 cut(s) 203
MalI GATC 2 cut(s) 315, 370
MboI GATC 2 cut(s) 313, 368
MboII GAAGA 1 cut(s) 29
MflI RGATCY 1 cut(s) 368
MluCI AATT 3 cut(s) 129, 209, 320
MmeI TCCRAC 1 cut(s) 199
MnlI CCTC 1 cut(s) 379
Mph1103I ATGCAT 1 cut(s) 163
MseI TTAA 2 cut(s) 96, 104
MspR9I CCNGG 1 cut(s) 181
MvaI CCWGG 1 cut(s) 181
MwoI GCNNNNNNNGC 1 cut(s) 125
NdeII GATC 2 cut(s) 313, 368
NlaIII CATG 2 cut(s) 165, 354
NmuCI GTSAC 1 cut(s) 203
NsiI ATGCAT 1 cut(s) 163
NspI RCATGY 1 cut(s) 354
PaeI GCATGC 1 cut(s) 354
PfeI GAWTC 2 cut(s) 184, 246
PkrI GCNGC 2 cut(s) 52, 379
PsiI TTATAA 1 cut(s) 231
Psp6I CCWGG 1 cut(s) 179
PspFI CCCAGC 1 cut(s) 119
PspGI CCWGG 1 cut(s) 179
PsuI RGATCY 1 cut(s) 368
RsaI GTAC 1 cut(s) 395
RsaNI GTAC 1 cut(s) 394
SaqAI TTAA 2 cut(s) 96, 104
SatI GCNGC 2 cut(s) 51, 378
Sau3AI GATC 2 cut(s) 313, 368
ScrFI CCNGG 1 cut(s) 181
SetI ASST 7 cut(s) 10, 103, 121, 182, 312, 379, 390
SfaNI GCATC 2 cut(s) 61, 148
SfcI CTRYAG 2 cut(s) 372, 406
SphI GCATGC 1 cut(s) 354
Sse9I AATT 3 cut(s) 129, 209, 320
SspI AATATT 1 cut(s) 192
SspMI CTAG 1 cut(s) 436
StyD4I CCNGG 1 cut(s) 179
TaqI TCGA 2 cut(s) 24, 213
TasI AATT 3 cut(s) 129, 209, 320
TatI WGTACW 1 cut(s) 393
TfiI GAWTC 2 cut(s) 184, 246
Tru1I TTAA 2 cut(s) 96, 104
Tru9I TTAA 2 cut(s) 96, 104
TseFI GTSAC 1 cut(s) 203
TseI GCWGC 2 cut(s) 50, 377
Tsp45I GTSAC 1 cut(s) 203
TspDTI ATGAA 1 cut(s) 30
TspGWI ACGGA 1 cut(s) 128
XapI RAATTY 2 cut(s) 209, 320
XceI RCATGY 1 cut(s) 354
XspI CTAG 1 cut(s) 436
Zsp2I ATGCAT 1 cut(s) 163
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.