Rh3CG297700

Rhodanese-like domain-containing protein 11

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3C
Physical Location & Seq
Reverse (-)
30579159 .. 30584933
5775 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3CG297700.1

Sequence Viewer

Length: 315 bp
ATGCAAGCTGACAATGAAGATTTCGAGTTGAAGCAAATGAGAGATATGGCTGCTACCAAAAAAAGATGGGATGCTCTGGCATGGGTCAAAGGCTCAACCTGGATTCCAATATTTGATGTTGGTGACAAATTCGATGTTGGAACTCTTTATAAAAAGATTATGGGATTCACTATGGGGGGTTGGTGGAGTGGTGTGCCTACATTGGCGTATAACAAGAGCCTTCCTGACTATAGATATGGCTCAAGTGAAATGAGAAGAGAACACAACCACCAATTTCCTGATTATAGATATGGCTCAATTACATATATGCATTGA
Functional Annotation
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

104

Amino Acids

12.27

Weight (kDa)

7.95

Isoelectric Point (pI)

36.18

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 150
AcsI RAATTY 1 cut(s) 128
AgsI TTSAA 1 cut(s) 31
AjnI CCWGG 1 cut(s) 98
AluBI AGCT 1 cut(s) 8
AluI AGCT 1 cut(s) 8
ApeKI GCWGC 1 cut(s) 50
ApoI RAATTY 1 cut(s) 128
AsuHPI GGTGA 1 cut(s) 134
BbvI GCAGC 1 cut(s) 37
BccI CCATC 1 cut(s) 60
BciT130I CCWGG 1 cut(s) 100
BfmI CTRYAG 1 cut(s) 229
BisI GCNGC 1 cut(s) 51
BlsI GCNGC 1 cut(s) 52
Bme1390I CCNGG 1 cut(s) 100
BmrFI CCNGG 1 cut(s) 100
BmsI GCATC 1 cut(s) 61
BpuEI CTTGAG 1 cut(s) 226
BseBI CCWGG 1 cut(s) 100
BseGI GGATG 1 cut(s) 76
BseXI GCAGC 1 cut(s) 37
Bst2UI CCWGG 1 cut(s) 100
Bst6I CTCTTC 1 cut(s) 250
BstC8I GCNNGC 1 cut(s) 6
BstF5I GGATG 1 cut(s) 76
BstNI CCWGG 1 cut(s) 100
BstSCI CCNGG 1 cut(s) 98
BstSFI CTRYAG 1 cut(s) 229
BstV1I GCAGC 1 cut(s) 37
BtsCI GGATG 1 cut(s) 76
Cac8I GCNNGC 1 cut(s) 6
CviAII CATG 1 cut(s) 81
CviJI RGCY 6 cut(s) 8, 50, 93, 219, 240, 294
CviKI_1 RGCY 6 cut(s) 8, 50, 93, 219, 240, 294
Eam1104I CTCTTC 1 cut(s) 250
EarI CTCTTC 1 cut(s) 250
EcoRII CCWGG 1 cut(s) 98
EcoT22I ATGCAT 1 cut(s) 312
FaeI CATG 1 cut(s) 84
FatI CATG 1 cut(s) 80
Fnu4HI GCNGC 1 cut(s) 51
FokI GGATG 1 cut(s) 83
Fsp4HI GCNGC 1 cut(s) 51
GluI GCNGC 1 cut(s) 51
Hin1II CATG 1 cut(s) 84
HinfI GANTC 2 cut(s) 103, 165
HphI GGTGA 1 cut(s) 134
Hpy188III TCNNGA 2 cut(s) 224, 278
HpyAV CCTTC 1 cut(s) 230
HpyCH4V TGCA 2 cut(s) 4, 310
Hsp92II CATG 1 cut(s) 84
LpnPI CCDG 5 cut(s) 62, 85, 112, 237, 291
Lsp1109I GCAGC 1 cut(s) 37
LweI GCATC 1 cut(s) 61
MaeIII GTNAC 1 cut(s) 122
MboII GAAGA 2 cut(s) 29, 267
MluCI AATT 3 cut(s) 128, 272, 297
MmeI TCCRAC 1 cut(s) 118
Mph1103I ATGCAT 1 cut(s) 312
MspR9I CCNGG 1 cut(s) 100
MvaI CCWGG 1 cut(s) 100
NlaIII CATG 1 cut(s) 84
NmuCI GTSAC 1 cut(s) 122
NsiI ATGCAT 1 cut(s) 312
PfeI GAWTC 2 cut(s) 103, 165
PkrI GCNGC 1 cut(s) 52
PsiI TTATAA 1 cut(s) 150
Psp6I CCWGG 1 cut(s) 98
PspGI CCWGG 1 cut(s) 98
SatI GCNGC 1 cut(s) 51
ScrFI CCNGG 1 cut(s) 100
SetI ASST 2 cut(s) 10, 101
SfaNI GCATC 1 cut(s) 61
SfcI CTRYAG 1 cut(s) 229
SmlI CTYRAG 1 cut(s) 241
SmoI CTYRAG 1 cut(s) 241
Sse9I AATT 3 cut(s) 128, 272, 297
SspI AATATT 1 cut(s) 111
StyD4I CCNGG 1 cut(s) 98
TaqI TCGA 2 cut(s) 24, 132
TasI AATT 3 cut(s) 128, 272, 297
TfiI GAWTC 2 cut(s) 103, 165
TseFI GTSAC 1 cut(s) 122
TseI GCWGC 1 cut(s) 50
Tsp45I GTSAC 1 cut(s) 122
TspDTI ATGAA 1 cut(s) 30
XapI RAATTY 1 cut(s) 128
Zsp2I ATGCAT 1 cut(s) 312
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.