Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8321945.1

Orthogroup ID

OG0003495

Physical Location & Seq

Genomic Coordinates Reverse (-)

2 .. 780

Gene Structure 779 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8321945.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 371 bp

atggagcagaacaagaaaaaggtatcgaagggactattgcagagtgatgacttgtatcagtatatcttggagactagcgtgtatccgcgtgaaccggagcctctcaaggagctgagagaggccactgccagccaccccgaggctgggatggctactgcaccagatgcaggtcagttaatgaccatgctattgaagttagtagatgcaaagaagacgattgaagtaggagtttttaccggatactctcttctcctcactgctcttacaactcctgaggatggcaagattgtcgccatagatgtagatcgtgagccatatgatcaaataggatttccaatcataaagaaagctggtgttgagcacaaaattga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005829 GO:0008150 GO:0008152 GO:0008168 GO:0008171 GO:0008757 GO:0016740 GO:0016741 GO:0032259 GO:0042409 GO:0044424 GO:0044444 GO:0044464

KEGG Pathways

Metabolic & Signaling

ko00360 ko00940 ko00941 ko00945 ko01100 ko01110 map00360 map00940 map00941 map00945 map01100 map01110

Pfam Domains

Protein Families

Methyltransf_3

Protein Analysis

123

Amino Acids

13.6

Weight (kDa)

5.18

Isoelectric Point (pI)

30.26

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0003495)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT4G26220
fragaria_vesca	FvH4_1g06840 FvH4_1g06841 FvH4_1g06841
malus_domestica	MD02G1073100.v1.1 MD02G1073400.v1.1
prunus_persica	Prupe.7G214400_v2.0.a1 Prupe.7G214400_v2.0.a1 Prupe.7G214400_v2.0.a1
pyrus_communis	pycom02g05730 pycom02g05760 pycom02g05770
rosa_chinensis	RchiOBHm_Chr2g0092621 RchiOBHm_Chr2g0092631 RchiOBHm_Chr2g0093901 RchiOBHm_Chr2g0093911
rosa_laevigata	RLG00000016207 RLG00000016329
rosa_multiflora	Rmu_co8197646.1_g000001 Rmu_co8235837.1_g000001 Rmu_co8321945.1_g000001 Rmu_sc0003027.1_g000003
rosa_roxburghii	Rroxscaffold_2G00147620 Rroxscaffold_2G00147650 Rroxscaffold_2G00148920
rosa_rugosa	Rorug02G0028200 Rorug02G0028300
rosa_samantha	Rh2AG074000 Rh2AG074100 Rh2BG075100 Rh2BG075200 Rh2CG076700 Rh2CG076800
rosa_wichuraiana	Rw2G005890 Rw2G005900

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc36I	ACCTGC	1 cut(s)	158
AccII	CGCG	1 cut(s)	88
AciI	CCGC	1 cut(s)	86
AfiI	CCNNNNNNNGG	5 cut(s)	139, 143, 144, 167, 278
AgsI	TTSAA	2 cut(s)	193, 221
AluBI	AGCT	2 cut(s)	112, 350
AluI	AGCT	2 cut(s)	112, 350
Alw21I	GWGCWC	1 cut(s)	363
Alw26I	GTCTC	1 cut(s)	65
Ama87I	CYCGRG	1 cut(s)	137
AoxI	GGCC	1 cut(s)	120
AvaI	CYCGRG	1 cut(s)	137
AxyI	CCTNAGG	1 cut(s)	273
BbsI	GAAGAC	1 cut(s)	218
Bbv12I	GWGCWC	1 cut(s)	363
BccI	CCATC	2 cut(s)	142, 272
BcgI	CGANNNNNNTGC	2 cut(s)	271, 305
BciVI	GTATCC	2 cut(s)	93, 233
BclI	TGATCA	1 cut(s)	319
BcoDI	GTCTC	1 cut(s)	65
BfaI	CTAG	1 cut(s)	75
BfuAI	ACCTGC	1 cut(s)	158
BfuI	GTATCC	2 cut(s)	93, 233
BmeT110I	CYCGRG	1 cut(s)	137
BmiI	GGNNCC	1 cut(s)	99
BmsI	GCATC	2 cut(s)	154, 193
BpiI	GAAGAC	1 cut(s)	218
BpuEI	CTTGAG	1 cut(s)	89
BsaBI	GATNNNNATC	1 cut(s)	303
BsaJI	CCNNGG	1 cut(s)	138
BsaWI	WCCGGW	2 cut(s)	94, 236
Bsc4I	CCNNNNNNNGG	5 cut(s)	139, 143, 144, 167, 278
Bse21I	CCTNAGG	1 cut(s)	273
Bse8I	GATNNNNATC	1 cut(s)	303
BseDI	CCNNGG	1 cut(s)	138
BseGI	GGATG	2 cut(s)	153, 283
BseJI	GATNNNNATC	1 cut(s)	303
BseLI	CCNNNNNNNGG	5 cut(s)	139, 143, 144, 167, 278
BseMII	CTCAG	2 cut(s)	104, 264
BseRI	GAGGAG	1 cut(s)	242
BseYI	CCCAGC	1 cut(s)	143
BsgI	GTGCAG	1 cut(s)	141
Bsh1236I	CGCG	1 cut(s)	88
BshFI	GGCC	1 cut(s)	122
BsiHKAI	GWGCWC	1 cut(s)	363
BsiHKCI	CYCGRG	1 cut(s)	137
BsiSI	CCGG	2 cut(s)	95, 237
BslFI	GGGAC	1 cut(s)	45
BslI	CCNNNNNNNGG	5 cut(s)	139, 143, 144, 167, 278
BsmAI	GTCTC	1 cut(s)	65
BsmFI	GGGAC	1 cut(s)	45
BsnI	GGCC	1 cut(s)	122
BsoBI	CYCGRG	1 cut(s)	137
Bsp1286I	GDGCHC	1 cut(s)	363
Bsp143I	GATC	2 cut(s)	304, 319
BspACI	CCGC	1 cut(s)	86
BspANI	GGCC	1 cut(s)	122
BspCNI	CTCAG	2 cut(s)	105, 265
BspFNI	CGCG	1 cut(s)	88
BspLI	GGNNCC	1 cut(s)	99
BspMI	ACCTGC	1 cut(s)	158
BssECI	CCNNGG	1 cut(s)	138
BssMI	GATC	2 cut(s)	304, 319
Bst6I	CTCTTC	1 cut(s)	252
BstAPI	GCANNNNNTGC	1 cut(s)	164
BstC8I	GCNNGC	1 cut(s)	130
BstDEI	CTNAG	2 cut(s)	113, 273
BstF5I	GGATG	2 cut(s)	153, 283
BstFNI	CGCG	1 cut(s)	88
BstKTI	GATC	2 cut(s)	307, 322
BstMAI	GTCTC	1 cut(s)	65
BstMBI	GATC	2 cut(s)	304, 319
BstMWI	GCNNNNNNNGC	2 cut(s)	149, 164
BstUI	CGCG	1 cut(s)	88
BstV2I	GAAGAC	1 cut(s)	218
Bsu36I	CCTNAGG	1 cut(s)	273
BsuI	GTATCC	2 cut(s)	93, 233
BsuRI	GGCC	1 cut(s)	122
BtsCI	GGATG	2 cut(s)	153, 283
BtsI	GCAGTG	2 cut(s)	123, 255
BtsIMutI	CAGTG	2 cut(s)	123, 255
BveI	ACCTGC	1 cut(s)	158
Cac8I	GCNNGC	1 cut(s)	130
CviAII	CATG	1 cut(s)	184
CviJI	RGCY	8 cut(s)	100, 112, 122, 132, 143, 152, 313, 350
CviKI_1	RGCY	8 cut(s)	100, 112, 122, 132, 143, 152, 313, 350
DdeI	CTNAG	2 cut(s)	113, 273
DpnI	GATC	2 cut(s)	306, 321
DpnII	GATC	2 cut(s)	304, 319
Eam1104I	CTCTTC	1 cut(s)	252
EarI	CTCTTC	1 cut(s)	252
Eco81I	CCTNAGG	1 cut(s)	273
Eco88I	CYCGRG	1 cut(s)	137
FaeI	CATG	1 cut(s)	187
FaiI	YATR	6 cut(s)	63, 185, 296, 316, 318, 341
FaqI	GGGAC	1 cut(s)	45
FatI	CATG	1 cut(s)	183
FauNDI	CATATG	1 cut(s)	316
FbaI	TGATCA	1 cut(s)	319
FokI	GGATG	2 cut(s)	160, 290
FspBI	CTAG	1 cut(s)	75
GsaI	CCCAGC	1 cut(s)	147
HaeIII	GGCC	1 cut(s)	122
HapII	CCGG	2 cut(s)	95, 237
Hin1II	CATG	1 cut(s)	187
HpaII	CCGG	2 cut(s)	95, 237
Hpy166II	GTNNAC	1 cut(s)	92
Hpy188III	TCNNGA	2 cut(s)	272, 308
Hpy8I	GTNNAC	1 cut(s)	92
HpyAV	CCTTC	1 cut(s)	22
HpyCH4V	TGCA	4 cut(s)	40, 158, 167, 206
HpyF10VI	GCNNNNNNNGC	2 cut(s)	149, 164
HpyF3I	CTNAG	2 cut(s)	113, 273
Hsp92II	CATG	1 cut(s)	187
Ksp22I	TGATCA	1 cut(s)	319
Kzo9I	GATC	2 cut(s)	304, 319
LmnI	GCTCC	3 cut(s)	4, 97, 109
LpnPI	CCDG	8 cut(s)	108, 129, 142, 153, 174, 250, 285, 336
LweI	GCATC	2 cut(s)	154, 193
MaeI	CTAG	1 cut(s)	75
MalI	GATC	2 cut(s)	306, 321
MboI	GATC	2 cut(s)	304, 319
MboII	GAAGA	2 cut(s)	223, 239
MhlI	GDGCHC	1 cut(s)	363
MluCI	AATT	1 cut(s)	366
MnlI	CCTC	5 cut(s)	111, 112, 133, 263, 268
MseI	TTAA	1 cut(s)	176
MspI	CCGG	2 cut(s)	95, 237
MvnI	CGCG	1 cut(s)	88
MwoI	GCNNNNNNNGC	2 cut(s)	149, 164
NdeI	CATATG	1 cut(s)	316
NdeII	GATC	2 cut(s)	304, 319
NlaIII	CATG	1 cut(s)	187
NlaIV	GGNNCC	1 cut(s)	99
PspFI	CCCAGC	1 cut(s)	143
PspN4I	GGNNCC	1 cut(s)	99
SaqAI	TTAA	1 cut(s)	176
Sau3AI	GATC	2 cut(s)	304, 319
SduI	GDGCHC	1 cut(s)	363
SetI	ASST	4 cut(s)	24, 114, 172, 352
SfaNI	GCATC	2 cut(s)	154, 193
SmlI	CTYRAG	1 cut(s)	104
SmoI	CTYRAG	1 cut(s)	104
Sse9I	AATT	1 cut(s)	366
SsiI	CCGC	1 cut(s)	86
SspMI	CTAG	1 cut(s)	75
TaqI	TCGA	1 cut(s)	26
TasI	AATT	1 cut(s)	366
Tru1I	TTAA	1 cut(s)	176
Tru9I	TTAA	1 cut(s)	176
TscAI	CASTG	2 cut(s)	130, 262
TspRI	CASTG	2 cut(s)	130, 262
XcmI	CCANNNNNNNNNTGG	1 cut(s)	140
XspI	CTAG	1 cut(s)	75

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.