Rmu_co8322135.1_g000001

SNF2 domain-containing protein CLASSY

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8322135.1
Physical Location & Seq
Forward (+)
1 .. 524
524 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8322135.1_g000001.1.cds

Sequence Viewer

Length: 444 bp
gccaaaggaaacaacttttcaaggtcctttaattcacgaaaggatgacaaagatgagacatatggtggtagtcgtccagaaacatataagaagagagaaagggtggggaatcttaccaacaaaaagggcattacagcaccaaaagattgcaatgcctttatgattcttgtagattcgatttatgacaagggagaagtgtcaggggaactacctccgtttggggatgaatccccccaagatgaagctccaagagatgagcctcttccattgtttttcacgcttggtcatcctccaagtcctgcaccagagaagtcagcttctgagatagaactagaaaacctttttgaagaatatgactttgtccaaatgtctgaagagattggttccactgattctaaactggtaggttggctcaaacagcactcctataaatctactcattaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

147

Amino Acids

16.52

Weight (kDa)

4.94

Isoelectric Point (pI)

62.79

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 393
AfiI CCNNNNNNNGG 1 cut(s) 218
AgsI TTSAA 2 cut(s) 21, 347
AluBI AGCT 2 cut(s) 245, 317
AluI AGCT 2 cut(s) 245, 317
Alw26I GTCTC 1 cut(s) 50
AlwNI CAGNNNCTG 1 cut(s) 320
AspS9I GGNCC 1 cut(s) 24
AvaII GGWCC 1 cut(s) 24
BcoDI GTCTC 1 cut(s) 50
BfaI CTAG 1 cut(s) 332
Bme18I GGWCC 1 cut(s) 24
BmgT120I GGNCC 1 cut(s) 24
BmiI GGNNCC 1 cut(s) 385
Bsc4I CCNNNNNNNGG 1 cut(s) 218
Bse1I ACTGG 1 cut(s) 405
Bse3DI GCAATG 1 cut(s) 157
BseGI GGATG 3 cut(s) 49, 229, 286
BseLI CCNNNNNNNGG 1 cut(s) 218
BseMI GCAATG 1 cut(s) 157
BseMII CTCAG 1 cut(s) 312
BseNI ACTGG 1 cut(s) 405
BsgI GTGCAG 1 cut(s) 285
BslI CCNNNNNNNGG 1 cut(s) 218
BsmAI GTCTC 1 cut(s) 50
BspCNI CTCAG 1 cut(s) 313
BspLI GGNNCC 1 cut(s) 385
BsrDI GCAATG 1 cut(s) 157
BsrI ACTGG 1 cut(s) 405
Bst6I CTCTTC 3 cut(s) 86, 267, 369
BstDEI CTNAG 1 cut(s) 321
BstF5I GGATG 3 cut(s) 49, 229, 286
BstMAI GTCTC 1 cut(s) 50
BstMWI GCNNNNNNNGC 1 cut(s) 418
BtsCI GGATG 3 cut(s) 49, 229, 286
BtsIMutI CAGTG 1 cut(s) 387
CaiI CAGNNNCTG 1 cut(s) 320
Cfr13I GGNCC 1 cut(s) 24
CviJI RGCY 4 cut(s) 245, 259, 317, 412
CviKI_1 RGCY 4 cut(s) 245, 259, 317, 412
DdeI CTNAG 1 cut(s) 321
Eam1104I CTCTTC 3 cut(s) 86, 267, 369
EarI CTCTTC 3 cut(s) 86, 267, 369
Eco47I GGWCC 1 cut(s) 24
Eco57I CTGAAG 1 cut(s) 393
EcoO109I RGGNCCY 1 cut(s) 24
FaiI YATR 8 cut(s) 61, 63, 85, 87, 161, 183, 354, 429
FauNDI CATATG 1 cut(s) 61
FokI GGATG 3 cut(s) 56, 236, 273
FspBI CTAG 1 cut(s) 332
HinfI GANTC 5 cut(s) 109, 163, 173, 227, 392
Hpy188I TCNGA 2 cut(s) 322, 373
Hpy188III TCNNGA 2 cut(s) 36, 77
HpyCH4V TGCA 2 cut(s) 150, 302
HpyF10VI GCNNNNNNNGC 1 cut(s) 418
HpyF3I CTNAG 1 cut(s) 321
LmnI GCTCC 1 cut(s) 250
LpnPI CCDG 5 cut(s) 90, 186, 312, 318, 386
MaeI CTAG 1 cut(s) 332
MboII GAAGA 4 cut(s) 103, 254, 359, 386
MluCI AATT 1 cut(s) 31
MnlI CCTC 3 cut(s) 222, 270, 300
MseI TTAA 2 cut(s) 30, 442
MwoI GCNNNNNNNGC 1 cut(s) 418
NdeI CATATG 1 cut(s) 61
NlaIV GGNNCC 1 cut(s) 385
PfeI GAWTC 5 cut(s) 109, 163, 173, 227, 392
PflFI GACNNNGTC 1 cut(s) 359
PpuMI RGGWCCY 1 cut(s) 24
Psp5II RGGWCCY 1 cut(s) 24
PspN4I GGNNCC 1 cut(s) 385
PspPI GGNCC 1 cut(s) 24
PspPPI RGGWCCY 1 cut(s) 24
PstNI CAGNNNCTG 1 cut(s) 320
PsyI GACNNNGTC 1 cut(s) 359
SaqAI TTAA 2 cut(s) 30, 442
Sau96I GGNCC 1 cut(s) 24
SetI ASST 6 cut(s) 26, 214, 247, 319, 342, 409
SinI GGWCC 1 cut(s) 24
Sse9I AATT 1 cut(s) 31
SspMI CTAG 1 cut(s) 332
TaqI TCGA 1 cut(s) 176
TasI AATT 1 cut(s) 31
TfiI GAWTC 5 cut(s) 109, 163, 173, 227, 392
Tru1I TTAA 2 cut(s) 30, 442
Tru9I TTAA 2 cut(s) 30, 442
TscAI CASTG 1 cut(s) 394
TspDTI ATGAA 2 cut(s) 240, 255
TspGWI ACGGA 1 cut(s) 204
TspRI CASTG 1 cut(s) 394
Tth111I GACNNNGTC 1 cut(s) 359
VpaK11BI GGWCC 1 cut(s) 24
XspI CTAG 1 cut(s) 332
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.