Rh1DG190100

Ribosomal L37ae protein family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1D
OG0002592
Physical Location & Seq
Forward (+)
37991668 .. 37993967
2300 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1DG190100.1

Sequence Viewer

Length: 219 bp
ATGACAAAGAGAACCAAGAAGGCTGGTATTGTCGGGAAGTATGGAACCCGATATGGTGCTAGTCTGAGGAAGCAGATTAAGAAGATGGAGGTCAGTCAGCACAGCAAGTACTTCTGTGAATTTTGCGGCAAGTATGCGGTGAAGAGAAAGGCTGTTGGAATCTGGGGTTGCAAAGACTGCGGCAAAGTGAAAGCTGGAGGTGCCTACACACTCAAGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko03010 map03010
Pfam Domains
Protein Families
Ribosomal_L37ae

Protein Analysis

72

Amino Acids

8.03

Weight (kDa)

10.11

Isoelectric Point (pI)

13.35

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Ribosomal_L37ae PF01780 4 - 71 3.2e-32 Ribosomal L37ae protein family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 200
AciI CCGC 3 cut(s) 126, 137, 180
AcsI RAATTY 1 cut(s) 119
AfaI GTAC 1 cut(s) 110
AluBI AGCT 1 cut(s) 194
AluI AGCT 1 cut(s) 194
ApoI RAATTY 1 cut(s) 119
AsuHPI GGTGA 1 cut(s) 151
BanI GGYRCC 1 cut(s) 200
BccI CCATC 1 cut(s) 79
BfaI CTAG 1 cut(s) 60
BisI GCNGC 2 cut(s) 127, 181
BlsI GCNGC 2 cut(s) 128, 182
BmcAI AGTACT 1 cut(s) 110
BmiI GGNNCC 2 cut(s) 46, 202
BpmI CTGGAG 1 cut(s) 216
BpuEI CTTGAG 1 cut(s) 197
BseMII CTCAG 1 cut(s) 56
BshNI GGYRCC 1 cut(s) 200
BspACI CCGC 3 cut(s) 126, 137, 180
BspCNI CTCAG 1 cut(s) 57
BspLI GGNNCC 2 cut(s) 46, 202
BspT107I GGYRCC 1 cut(s) 200
Bst6I CTCTTC 1 cut(s) 137
BstAPI GCANNNNNTGC 1 cut(s) 177
BstDEI CTNAG 1 cut(s) 65
BstMWI GCNNNNNNNGC 2 cut(s) 177, 200
Csp6I GTAC 1 cut(s) 109
CviJI RGCY 3 cut(s) 23, 152, 194
CviKI_1 RGCY 3 cut(s) 23, 152, 194
CviQI GTAC 1 cut(s) 109
DdeI CTNAG 1 cut(s) 65
Eam1104I CTCTTC 1 cut(s) 137
EarI CTCTTC 1 cut(s) 137
FaiI YATR 3 cut(s) 42, 54, 135
Fnu4HI GCNGC 2 cut(s) 127, 181
Fsp4HI GCNGC 2 cut(s) 127, 181
FspBI CTAG 1 cut(s) 60
GluI GCNGC 2 cut(s) 127, 181
GsuI CTGGAG 1 cut(s) 216
HinfI GANTC 1 cut(s) 159
HphI GGTGA 1 cut(s) 151
Hpy188I TCNGA 1 cut(s) 66
Hpy188III TCNNGA 1 cut(s) 34
HpyAV CCTTC 1 cut(s) 13
HpyCH4V TGCA 1 cut(s) 171
HpyF10VI GCNNNNNNNGC 2 cut(s) 177, 200
HpyF3I CTNAG 1 cut(s) 65
LpnPI CCDG 3 cut(s) 9, 148, 180
MaeI CTAG 1 cut(s) 60
MboII GAAGA 2 cut(s) 94, 154
MluCI AATT 1 cut(s) 119
MmeI TCCRAC 1 cut(s) 136
MnlI CCTC 3 cut(s) 60, 82, 191
MseI TTAA 1 cut(s) 78
MwoI GCNNNNNNNGC 2 cut(s) 177, 200
NlaIV GGNNCC 2 cut(s) 46, 202
PfeI GAWTC 1 cut(s) 159
PkrI GCNGC 2 cut(s) 128, 182
PspN4I GGNNCC 2 cut(s) 46, 202
RsaI GTAC 1 cut(s) 110
RsaNI GTAC 1 cut(s) 109
SaqAI TTAA 1 cut(s) 78
SatI GCNGC 2 cut(s) 127, 181
ScaI AGTACT 1 cut(s) 110
SetI ASST 3 cut(s) 93, 196, 202
SgeI CNNG 9 cut(s) 28, 36, 46, 60, 72, 118, 142, 175, 207
SmlI CTYRAG 1 cut(s) 212
SmoI CTYRAG 1 cut(s) 212
Sse9I AATT 1 cut(s) 119
SsiI CCGC 3 cut(s) 126, 137, 180
SspMI CTAG 1 cut(s) 60
TasI AATT 1 cut(s) 119
TatI WGTACW 1 cut(s) 108
TauI GCSGC 2 cut(s) 129, 183
TfiI GAWTC 1 cut(s) 159
Tru1I TTAA 1 cut(s) 78
Tru9I TTAA 1 cut(s) 78
XapI RAATTY 1 cut(s) 119
XspI CTAG 1 cut(s) 60
ZrmI AGTACT 1 cut(s) 110
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.