Rw7G019760

SNF2 domain-containing protein CLASSY

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr7
OG0002592
Physical Location & Seq
Reverse (-)
21967766 .. 21969833
2068 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw7G019760.1

Sequence Viewer

Length: 525 bp
ATGAGGAGGTACAACCAGGCTTCTGTTCCCCAAGATGAAACTCCAAGAGATACAACCAGGCCTCTTCCAATGTTTTTCAGGCTTGGTCATCCTTCAAGTCCTGCACCAGAGAAGTCAGCTTCTGAGATAGAACTAGAAGAACTTTGTGAAGAATTTGACTCTGCCCTCATGTCTGAAGGGATTGGTTCCACTGATTCTATTGTGGTTGAAACTAATGACTCAATCCCTCTTGATCAGGAAGTTACTCAGCATATGCTTTGTAGTCAAGGGAACCATCATCTTATACTTGATATTGAAATTGGACGGTATTGCAAATTCTGCCCTTATGTGCATCAGGAGATCAAGTATATTTTACCAGACTTTGCTCCAAACCCCTATGGAAAAGCTAGGAAGAGATTTGATGAAGAAGACAACTGGGTTGATGATTGTCAGGTTGAGGATGGCGAAGAAGTATGTGGTTCAAAGAAGCATATGACGGATTATCAACTTTCTATCTTCCAGTTTCTTTCTTGTGTTATTTCTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko03440 map03440
Pfam Domains
Protein Families
Helicase_C SNF2_N

Protein Analysis

174

Amino Acids

19.92

Weight (kDa)

4.56

Isoelectric Point (pI)

53.06

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 152, 314
AcuI CTGAAG 1 cut(s) 195
AfaI GTAC 1 cut(s) 11
AgsI TTSAA 4 cut(s) 96, 209, 296, 462
AjnI CCWGG 2 cut(s) 15, 56
AluBI AGCT 2 cut(s) 119, 386
AluI AGCT 2 cut(s) 119, 386
AlwNI CAGNNNCTG 1 cut(s) 122
AoxI GGCC 1 cut(s) 59
ApoI RAATTY 2 cut(s) 152, 314
BbsI GAAGAC 1 cut(s) 414
BccI CCATC 2 cut(s) 282, 434
BciT130I CCWGG 2 cut(s) 17, 58
BclI TGATCA 1 cut(s) 232
BfaI CTAG 2 cut(s) 134, 387
Bme1390I CCNGG 2 cut(s) 17, 58
BmiI GGNNCC 2 cut(s) 187, 272
BmrFI CCNGG 2 cut(s) 17, 58
BmrI ACTGGG 1 cut(s) 424
BmsI GCATC 1 cut(s) 340
BmuI ACTGGG 1 cut(s) 424
BpiI GAAGAC 1 cut(s) 414
BsaXI ACNNNNNCTCC 2 cut(s) 329, 359
Bse1I ACTGG 2 cut(s) 419, 499
BseBI CCWGG 2 cut(s) 17, 58
BseGI GGATG 2 cut(s) 88, 445
BseMII CTCAG 2 cut(s) 114, 260
BseNI ACTGG 2 cut(s) 419, 499
BseRI GAGGAG 1 cut(s) 19
BsgI GTGCAG 1 cut(s) 87
BshFI GGCC 1 cut(s) 61
BsnI GGCC 1 cut(s) 61
Bsp143I GATC 2 cut(s) 232, 339
BspANI GGCC 1 cut(s) 61
BspCNI CTCAG 2 cut(s) 115, 259
BspLI GGNNCC 2 cut(s) 187, 272
BsrI ACTGG 2 cut(s) 419, 499
BssMI GATC 2 cut(s) 232, 339
Bst2UI CCWGG 2 cut(s) 17, 58
Bst4CI ACNGT 1 cut(s) 306
Bst6I CTCTTC 2 cut(s) 69, 386
BstAPI GCANNNNNTGC 1 cut(s) 318
BstDEI CTNAG 3 cut(s) 123, 246, 522
BstF5I GGATG 2 cut(s) 88, 445
BstKTI GATC 2 cut(s) 235, 342
BstMBI GATC 2 cut(s) 232, 339
BstMWI GCNNNNNNNGC 1 cut(s) 318
BstNI CCWGG 2 cut(s) 17, 58
BstSCI CCNGG 2 cut(s) 15, 56
BstV2I GAAGAC 1 cut(s) 414
BsuRI GGCC 1 cut(s) 61
BtsCI GGATG 2 cut(s) 88, 445
BtsIMutI CAGTG 1 cut(s) 189
CaiI CAGNNNCTG 1 cut(s) 122
Csp6I GTAC 1 cut(s) 10
CviAII CATG 1 cut(s) 169
CviJI RGCY 5 cut(s) 20, 61, 82, 119, 386
CviKI_1 RGCY 5 cut(s) 20, 61, 82, 119, 386
CviQI GTAC 1 cut(s) 10
DdeI CTNAG 3 cut(s) 123, 246, 522
DpnI GATC 2 cut(s) 234, 341
DpnII GATC 2 cut(s) 232, 339
Eam1104I CTCTTC 2 cut(s) 69, 386
EarI CTCTTC 2 cut(s) 69, 386
Eco147I AGGCCT 1 cut(s) 61
Eco57I CTGAAG 1 cut(s) 195
EcoRII CCWGG 2 cut(s) 15, 56
FaeI CATG 1 cut(s) 172
FatI CATG 1 cut(s) 168
FauNDI CATATG 2 cut(s) 252, 471
FbaI TGATCA 1 cut(s) 232
FokI GGATG 2 cut(s) 75, 452
FspBI CTAG 2 cut(s) 134, 387
HaeIII GGCC 1 cut(s) 61
Hin1II CATG 1 cut(s) 172
HinfI GANTC 3 cut(s) 158, 194, 218
Hpy188I TCNGA 2 cut(s) 124, 175
Hpy188III TCNNGA 3 cut(s) 230, 236, 335
HpyAV CCTTC 2 cut(s) 102, 170
HpyCH4III ACNGT 1 cut(s) 306
HpyCH4V TGCA 3 cut(s) 104, 312, 331
HpyF10VI GCNNNNNNNGC 1 cut(s) 318
HpyF3I CTNAG 3 cut(s) 123, 246, 522
Hsp92II CATG 1 cut(s) 172
Ksp22I TGATCA 1 cut(s) 232
Kzo9I GATC 2 cut(s) 232, 339
LmnI GCTCC 1 cut(s) 370
LweI GCATC 1 cut(s) 340
MaeI CTAG 2 cut(s) 134, 387
MaeIII GTNAC 1 cut(s) 241
MalI GATC 2 cut(s) 234, 341
MboI GATC 2 cut(s) 232, 339
MboII GAAGA 8 cut(s) 56, 149, 161, 403, 416, 419, 458, 487
MluCI AATT 3 cut(s) 152, 297, 314
MlyI GAGTC 2 cut(s) 152, 212
MnlI CCTC 4 cut(s) 72, 176, 237, 430
MspR9I CCNGG 2 cut(s) 17, 58
MvaI CCWGG 2 cut(s) 17, 58
MwoI GCNNNNNNNGC 1 cut(s) 318
NdeI CATATG 2 cut(s) 252, 471
NdeII GATC 2 cut(s) 232, 339
NlaIII CATG 1 cut(s) 172
NlaIV GGNNCC 2 cut(s) 187, 272
PceI AGGCCT 1 cut(s) 61
PfeI GAWTC 1 cut(s) 194
PleI GAGTC 2 cut(s) 152, 212
PpsI GAGTC 2 cut(s) 152, 212
Psp6I CCWGG 2 cut(s) 15, 56
PspGI CCWGG 2 cut(s) 15, 56
PspN4I GGNNCC 2 cut(s) 187, 272
PstNI CAGNNNCTG 1 cut(s) 122
RsaI GTAC 1 cut(s) 11
RsaNI GTAC 1 cut(s) 10
Sau3AI GATC 2 cut(s) 232, 339
SchI GAGTC 2 cut(s) 152, 212
ScrFI CCNGG 2 cut(s) 17, 58
SetI ASST 4 cut(s) 11, 121, 388, 435
SfaNI GCATC 1 cut(s) 340
Sse9I AATT 3 cut(s) 152, 297, 314
SseBI AGGCCT 1 cut(s) 61
SspMI CTAG 2 cut(s) 134, 387
StuI AGGCCT 1 cut(s) 61
StyD4I CCNGG 2 cut(s) 15, 56
TaaI ACNGT 1 cut(s) 306
TasI AATT 3 cut(s) 152, 297, 314
TfiI GAWTC 1 cut(s) 194
TscAI CASTG 1 cut(s) 196
TspDTI ATGAA 2 cut(s) 51, 417
TspGWI ACGGA 1 cut(s) 491
TspRI CASTG 1 cut(s) 196
XapI RAATTY 2 cut(s) 152, 314
XspI CTAG 2 cut(s) 134, 387
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.