Rmu_sc0000390.1_g000003

60S ribosomal Protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000390.1
Physical Location & Seq
Forward (+)
19385 .. 21036
1652 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000390.1_g000003.1.cds

Sequence Viewer

Length: 279 bp
atgacgaagagaaccaagaaggctggtattgtcgggaagtatggaacccgatatggtgctagtttgaggaagcagattaagaagatggaggtcagtcagcacagcaagtacttctgtgaattttgcggcaagtatgctgtgaagagaaaggctgttggaatctggggttgcaaagactgcggcaaagtgaaagctggaggtgcctacacactcaatactgcaagtgccgtgacagttaggagcaccatccgaaggctcagggagcagactgagagttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

92

Amino Acids

10.26

Weight (kDa)

10.24

Isoelectric Point (pI)

31.07

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 200
AciI CCGC 2 cut(s) 126, 180
AcsI RAATTY 1 cut(s) 119
AfaI GTAC 1 cut(s) 110
AfiI CCNNNNNNNGG 1 cut(s) 252
AluBI AGCT 1 cut(s) 194
AluI AGCT 1 cut(s) 194
Alw21I GWGCWC 1 cut(s) 245
ApoI RAATTY 1 cut(s) 119
BanI GGYRCC 1 cut(s) 200
Bbv12I GWGCWC 1 cut(s) 245
BccI CCATC 2 cut(s) 79, 254
BceAI ACGGC 1 cut(s) 212
BfaI CTAG 1 cut(s) 60
BisI GCNGC 2 cut(s) 127, 181
BlsI GCNGC 2 cut(s) 128, 182
BmcAI AGTACT 1 cut(s) 110
BmiI GGNNCC 2 cut(s) 46, 202
BpmI CTGGAG 1 cut(s) 216
Bpu10I CCTNAGC 1 cut(s) 257
Bsc4I CCNNNNNNNGG 1 cut(s) 252
BseGI GGATG 1 cut(s) 246
BseLI CCNNNNNNNGG 1 cut(s) 252
BseMII CTCAG 2 cut(s) 261, 271
BshNI GGYRCC 1 cut(s) 200
BsiHKAI GWGCWC 1 cut(s) 245
BslI CCNNNNNNNGG 1 cut(s) 252
Bsp1286I GDGCHC 1 cut(s) 245
BspACI CCGC 2 cut(s) 126, 180
BspCNI CTCAG 2 cut(s) 262, 270
BspLI GGNNCC 2 cut(s) 46, 202
BspT107I GGYRCC 1 cut(s) 200
Bst4CI ACNGT 1 cut(s) 235
Bst6I CTCTTC 2 cut(s) 2, 137
BstAPI GCANNNNNTGC 1 cut(s) 177
BstDEI CTNAG 2 cut(s) 257, 270
BstF5I GGATG 1 cut(s) 246
BstMWI GCNNNNNNNGC 3 cut(s) 177, 200, 262
BtsCI GGATG 1 cut(s) 246
Csp6I GTAC 1 cut(s) 109
CviJI RGCY 4 cut(s) 23, 152, 194, 256
CviKI_1 RGCY 4 cut(s) 23, 152, 194, 256
CviQI GTAC 1 cut(s) 109
DdeI CTNAG 2 cut(s) 257, 270
Eam1104I CTCTTC 2 cut(s) 2, 137
EarI CTCTTC 2 cut(s) 2, 137
FaiI YATR 3 cut(s) 42, 54, 135
Fnu4HI GCNGC 2 cut(s) 127, 181
FokI GGATG 1 cut(s) 233
Fsp4HI GCNGC 2 cut(s) 127, 181
FspBI CTAG 1 cut(s) 60
GluI GCNGC 2 cut(s) 127, 181
GsuI CTGGAG 1 cut(s) 216
HinfI GANTC 1 cut(s) 159
Hpy188I TCNGA 1 cut(s) 251
Hpy188III TCNNGA 1 cut(s) 34
HpyAV CCTTC 2 cut(s) 13, 246
HpyCH4III ACNGT 1 cut(s) 235
HpyCH4V TGCA 2 cut(s) 171, 221
HpyF10VI GCNNNNNNNGC 3 cut(s) 177, 200, 262
HpyF3I CTNAG 2 cut(s) 257, 270
LmnI GCTCC 2 cut(s) 240, 262
LpnPI CCDG 4 cut(s) 9, 148, 180, 244
MaeI CTAG 1 cut(s) 60
MaeIII GTNAC 1 cut(s) 229
MboII GAAGA 3 cut(s) 19, 94, 154
MhlI GDGCHC 1 cut(s) 245
MluCI AATT 1 cut(s) 119
MmeI TCCRAC 1 cut(s) 136
MnlI CCTC 3 cut(s) 60, 82, 191
MseI TTAA 1 cut(s) 78
MwoI GCNNNNNNNGC 3 cut(s) 177, 200, 262
NlaIV GGNNCC 2 cut(s) 46, 202
NmuCI GTSAC 1 cut(s) 229
PfeI GAWTC 1 cut(s) 159
PkrI GCNGC 2 cut(s) 128, 182
PspN4I GGNNCC 2 cut(s) 46, 202
RsaI GTAC 1 cut(s) 110
RsaNI GTAC 1 cut(s) 109
SaqAI TTAA 1 cut(s) 78
SatI GCNGC 2 cut(s) 127, 181
ScaI AGTACT 1 cut(s) 110
SduI GDGCHC 1 cut(s) 245
SetI ASST 3 cut(s) 93, 196, 202
Sse9I AATT 1 cut(s) 119
SsiI CCGC 2 cut(s) 126, 180
SspMI CTAG 1 cut(s) 60
TaaI ACNGT 1 cut(s) 235
TasI AATT 1 cut(s) 119
TatI WGTACW 1 cut(s) 108
TauI GCSGC 2 cut(s) 129, 183
TfiI GAWTC 1 cut(s) 159
Tru1I TTAA 1 cut(s) 78
Tru9I TTAA 1 cut(s) 78
TseFI GTSAC 1 cut(s) 229
Tsp45I GTSAC 1 cut(s) 229
XapI RAATTY 1 cut(s) 119
XspI CTAG 1 cut(s) 60
ZrmI AGTACT 1 cut(s) 110
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.