Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8410883.1

Orthogroup ID

OG0002255

Physical Location & Seq

Genomic Coordinates Forward (+)

1 .. 756

Gene Structure 756 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8410883.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 324 bp

tcttccattgatatacacttgcttcgtgtagagtcaatccttctaggggagaaaattgtgactgagaagtctgtggttcaaactacacagatagcagatggagatgtctgtcataatatgactctgcccattcatgttatacttccccgtcttttgacatgtcctacagtctcagcagggccattctcgattgaatttaaagttgtcatagtcataacatttcagtcacaggtagccaaattgcattcaaaatctgatcctaccactcccagactatggcttgcaatggagactctaccgcttgaacttgttagaacaaggtaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0005215 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005768 GO:0006810 GO:0006886 GO:0008104 GO:0008150 GO:0008565 GO:0012505 GO:0015031 GO:0015833 GO:0031410 GO:0031982 GO:0033036 GO:0034613 GO:0042886 GO:0043226 GO:0043227 GO:0043229 GO:0044424 GO:0044444 GO:0044464 GO:0045184 GO:0046907 GO:0051179 GO:0051234 GO:0051641 GO:0051649 GO:0070727 GO:0071702 GO:0071705 GO:0097708

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Vps26

Protein Analysis

107

Amino Acids

11.88

Weight (kDa)

6.87

Isoelectric Point (pI)

41.05

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002255)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G48550 AT1G48550
fragaria_vesca	FvH4_5g17430 FvH4_5g17430 FvH4_5g17430 FvH4_5g17430 FvH4_5g17430 FvH4_5g17430
malus_domestica	MD06G1227700.v1.1
prunus_persica	Prupe.5G234100_v2.0.a1 Prupe.5G234100_v2.0.a1 Prupe.5G234100_v2.0.a1 Prupe.5G234100_v2.0.a1
pyrus_communis	pycom06g20400
rosa_chinensis	RchiOBHm_Chr5g0035741 RchiOBHm_Chr7g0178261 RchiOBHm_Chr7g0212051 RchiOBHm_Chr7g0224581
rosa_laevigata	RLG00000005458
rosa_multiflora	Rmu_co8410883.1_g000001 Rmu_sc0000607.1_g000038 Rmu_sc0004642.1_g000025 Rmu_sc0014842.1_g000011
rosa_roxburghii	Rroxscaffold_3G00275030 Rroxscaffold_5G00359350
rosa_rugosa	Rorug05G0210300 Rorug06G0415700 Rorug06G0415800
rosa_samantha	Rh1AG111500 Rh3AG217900 Rh5AG337300 Rh5CG416100 Rh5DG280200 Rh6AG209700 Rh7AG014500 Rh7BG014100 Rh7CG014000 Rh7CG014100 Rh7DG014300 Rh7DG014400
rosa_wichuraiana	Rw1G006280 Rw4G000530 Rw7G001150

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AasI	GACNNNNNNGTC	1 cut(s)	67
AccB7I	CCANNNNNTGG	1 cut(s)	276
AciI	CCGC	1 cut(s)	299
AclWI	GGATC	1 cut(s)	251
AcsI	RAATTY	1 cut(s)	194
AfiI	CCNNNNNNNGG	2 cut(s)	46, 276
AflIII	ACRYGT	1 cut(s)	158
AgsI	TTSAA	4 cut(s)	80, 194, 249, 305
Alw26I	GTCTC	2 cut(s)	175, 284
AlwI	GGATC	1 cut(s)	251
AoxI	GGCC	1 cut(s)	179
ApoI	RAATTY	1 cut(s)	194
AspS9I	GGNCC	1 cut(s)	179
BccI	CCATC	1 cut(s)	92
BcoDI	GTCTC	2 cut(s)	175, 284
BfaI	CTAG	1 cut(s)	44
BfmI	CTRYAG	1 cut(s)	165
BmgT120I	GGNCC	1 cut(s)	179
Bsc4I	CCNNNNNNNGG	2 cut(s)	46, 276
Bse3DI	GCAATG	1 cut(s)	291
BseLI	CCNNNNNNNGG	2 cut(s)	46, 276
BseMI	GCAATG	1 cut(s)	291
BseMII	CTCAG	2 cut(s)	54, 186
BshFI	GGCC	1 cut(s)	181
BslI	CCNNNNNNNGG	2 cut(s)	46, 276
BsmAI	GTCTC	2 cut(s)	175, 284
BsmI	GAATGC	1 cut(s)	244
BsnI	GGCC	1 cut(s)	181
Bsp143I	GATC	1 cut(s)	256
BspACI	CCGC	1 cut(s)	299
BspANI	GGCC	1 cut(s)	181
BspCNI	CTCAG	2 cut(s)	55, 185
BspPI	GGATC	1 cut(s)	251
BsrDI	GCAATG	1 cut(s)	291
BssMI	GATC	1 cut(s)	256
Bst4CI	ACNGT	1 cut(s)	169
BstC8I	GCNNGC	1 cut(s)	282
BstDEI	CTNAG	2 cut(s)	63, 172
BstKTI	GATC	1 cut(s)	259
BstMAI	GTCTC	2 cut(s)	175, 284
BstMBI	GATC	1 cut(s)	256
BstNSI	RCATGY	1 cut(s)	162
BstSFI	CTRYAG	1 cut(s)	165
BsuRI	GGCC	1 cut(s)	181
Cac8I	GCNNGC	1 cut(s)	282
Cfr13I	GGNCC	1 cut(s)	179
CviAII	CATG	2 cut(s)	134, 159
CviJI	RGCY	3 cut(s)	181, 236, 280
CviKI_1	RGCY	3 cut(s)	181, 236, 280
DdeI	CTNAG	2 cut(s)	63, 172
DpnI	GATC	1 cut(s)	258
DpnII	GATC	1 cut(s)	256
DraI	TTTAAA	1 cut(s)	199
DrdI	GACNNNNNNGTC	1 cut(s)	67
DseDI	GACNNNNNNGTC	1 cut(s)	67
FaeI	CATG	2 cut(s)	137, 162
FaiI	YATR	9 cut(s)	14, 114, 119, 135, 140, 160, 209, 215, 277
FatI	CATG	2 cut(s)	133, 158
FspBI	CTAG	1 cut(s)	44
HaeIII	GGCC	1 cut(s)	181
Hin1II	CATG	2 cut(s)	137, 162
HinfI	GANTC	3 cut(s)	32, 121, 292
Hpy188I	TCNGA	1 cut(s)	256
Hpy188III	TCNNGA	1 cut(s)	187
HpyAV	CCTTC	1 cut(s)	50
HpyCH4III	ACNGT	1 cut(s)	169
HpyCH4V	TGCA	2 cut(s)	244, 284
HpyF3I	CTNAG	2 cut(s)	63, 172
Hsp92II	CATG	2 cut(s)	137, 162
Kzo9I	GATC	1 cut(s)	256
LpnPI	CCDG	3 cut(s)	162, 215, 283
MaeI	CTAG	1 cut(s)	44
MaeIII	GTNAC	2 cut(s)	58, 225
MalI	GATC	1 cut(s)	258
MboI	GATC	1 cut(s)	256
MluCI	AATT	3 cut(s)	54, 194, 239
MlyI	GAGTC	3 cut(s)	41, 115, 286
MseI	TTAA	1 cut(s)	198
Mva1269I	GAATGC	1 cut(s)	244
NdeII	GATC	1 cut(s)	256
NlaIII	CATG	2 cut(s)	137, 162
NmuCI	GTSAC	2 cut(s)	58, 225
NspI	RCATGY	1 cut(s)	162
PciI	ACATGT	1 cut(s)	158
PctI	GAATGC	1 cut(s)	244
PflMI	CCANNNNNTGG	1 cut(s)	276
PleI	GAGTC	3 cut(s)	40, 115, 286
PpsI	GAGTC	3 cut(s)	40, 115, 286
PscI	ACATGT	1 cut(s)	158
PspPI	GGNCC	1 cut(s)	179
SaqAI	TTAA	1 cut(s)	198
Sau3AI	GATC	1 cut(s)	256
Sau96I	GGNCC	1 cut(s)	179
SchI	GAGTC	3 cut(s)	41, 115, 286
SetI	ASST	2 cut(s)	234, 323
SfcI	CTRYAG	1 cut(s)	165
Sse9I	AATT	3 cut(s)	54, 194, 239
SsiI	CCGC	1 cut(s)	299
SspMI	CTAG	1 cut(s)	44
TaaI	ACNGT	1 cut(s)	169
TaqI	TCGA	1 cut(s)	188
TasI	AATT	3 cut(s)	54, 194, 239
Tru1I	TTAA	1 cut(s)	198
Tru9I	TTAA	1 cut(s)	198
TseFI	GTSAC	2 cut(s)	58, 225
Tsp45I	GTSAC	2 cut(s)	58, 225
TspDTI	ATGAA	1 cut(s)	122
Van91I	CCANNNNNTGG	1 cut(s)	276
XapI	RAATTY	1 cut(s)	194
XceI	RCATGY	1 cut(s)	162
XspI	CTAG	1 cut(s)	44

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.