Rmu_sc0014842.1_g000011

Down syndrome critical region protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0014842.1
Physical Location & Seq
Forward (+)
59405 .. 59962
558 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0014842.1_g000011.1.cds

Sequence Viewer

Length: 312 bp
atgcatatcaggcaaccaagagaagatagcctcgaaaagttctatgagacattccatggaggaaatattaacattcagtatttagtgactgtagatatatcgagaggatacctgtataagtcgttatctacaacaatggagttcatagttgaaagtgataaagctgatgtaattgagcgaccagtttctccagagatggttgtcttttacattactcaggatacccaaagacatccgctacttcctcaactgaaatcaggtttgctggttacttccagttatatcctatctatctctagttactgttcttaa

Protein Analysis

103

Amino Acids

11.87

Weight (kDa)

5.49

Isoelectric Point (pI)

59.97

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 236
AgsI TTSAA 1 cut(s) 152
AluBI AGCT 1 cut(s) 164
AluI AGCT 1 cut(s) 164
Alw26I GTCTC 1 cut(s) 41
BccI CCATC 1 cut(s) 190
BciVI GTATCC 2 cut(s) 101, 214
BcoDI GTCTC 1 cut(s) 41
BfaI CTAG 1 cut(s) 297
BfmI CTRYAG 1 cut(s) 90
BfuI GTATCC 2 cut(s) 101, 214
BpmI CTGGAG 1 cut(s) 174
BsaJI CCNNGG 1 cut(s) 55
Bse1I ACTGG 2 cut(s) 182, 276
BseDI CCNNGG 1 cut(s) 55
BseGI GGATG 1 cut(s) 232
BseMII CTCAG 1 cut(s) 230
BseNI ACTGG 2 cut(s) 182, 276
BsmAI GTCTC 1 cut(s) 41
Bsp19I CCATGG 1 cut(s) 55
BspACI CCGC 1 cut(s) 236
BspCNI CTCAG 1 cut(s) 229
BsrI ACTGG 2 cut(s) 182, 276
BssECI CCNNGG 1 cut(s) 55
BssT1I CCWWGG 1 cut(s) 55
Bst4CI ACNGT 2 cut(s) 91, 305
BstDEI CTNAG 1 cut(s) 216
BstDSI CCRYGG 1 cut(s) 55
BstF5I GGATG 1 cut(s) 232
BstMAI GTCTC 1 cut(s) 41
BstMWI GCNNNNNNNGC 1 cut(s) 10
BstSFI CTRYAG 1 cut(s) 90
BsuI GTATCC 2 cut(s) 101, 214
BtgI CCRYGG 1 cut(s) 55
BtsCI GGATG 1 cut(s) 232
CviAII CATG 1 cut(s) 56
CviJI RGCY 2 cut(s) 30, 164
CviKI_1 RGCY 2 cut(s) 30, 164
DdeI CTNAG 1 cut(s) 216
Eco130I CCWWGG 1 cut(s) 55
EcoT14I CCWWGG 1 cut(s) 55
EcoT22I ATGCAT 1 cut(s) 6
ErhI CCWWGG 1 cut(s) 55
FaeI CATG 1 cut(s) 59
FaiI YATR 7 cut(s) 6, 45, 57, 98, 117, 146, 282
FatI CATG 1 cut(s) 55
FokI GGATG 1 cut(s) 219
FspBI CTAG 1 cut(s) 297
GsuI CTGGAG 1 cut(s) 174
Hin1II CATG 1 cut(s) 59
Hpy188III TCNNGA 3 cut(s) 102, 191, 218
HpyCH4III ACNGT 2 cut(s) 91, 305
HpyCH4V TGCA 1 cut(s) 4
HpyF10VI GCNNNNNNNGC 1 cut(s) 10
HpyF3I CTNAG 1 cut(s) 216
Hsp92II CATG 1 cut(s) 59
LpnPI CCDG 7 cut(s) 125, 195, 203, 204, 243, 251, 289
MaeI CTAG 1 cut(s) 297
MaeIII GTNAC 3 cut(s) 85, 268, 299
MboII GAAGA 1 cut(s) 35
MluCI AATT 1 cut(s) 171
MnlI CCTC 4 cut(s) 41, 53, 98, 255
Mph1103I ATGCAT 1 cut(s) 6
MseI TTAA 2 cut(s) 69, 310
MwoI GCNNNNNNNGC 1 cut(s) 10
NcoI CCATGG 1 cut(s) 55
NlaIII CATG 1 cut(s) 59
NmuCI GTSAC 1 cut(s) 85
NsiI ATGCAT 1 cut(s) 6
SaqAI TTAA 2 cut(s) 69, 310
SetI ASST 3 cut(s) 114, 166, 262
SfcI CTRYAG 1 cut(s) 90
Sse9I AATT 1 cut(s) 171
SsiI CCGC 1 cut(s) 236
SspI AATATT 1 cut(s) 67
SspMI CTAG 1 cut(s) 297
StyI CCWWGG 1 cut(s) 55
TaaI ACNGT 2 cut(s) 91, 305
TaqI TCGA 2 cut(s) 33, 101
TasI AATT 1 cut(s) 171
Tru1I TTAA 2 cut(s) 69, 310
Tru9I TTAA 2 cut(s) 69, 310
TseFI GTSAC 1 cut(s) 85
Tsp45I GTSAC 1 cut(s) 85
TspDTI ATGAA 1 cut(s) 133
XspI CTAG 1 cut(s) 297
Zsp2I ATGCAT 1 cut(s) 6
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.