Rmu_co8450077.1_g000002

Palmitoyl-protein thioesterase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8450077.1
Physical Location & Seq
Reverse (-)
1416 .. 1643
228 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8450077.1_g000002.1.cds

Sequence Viewer

Length: 228 bp
atgcagactgatctgtacattgaagactggattggtttgagaacattggatgaagctggaagggtcaagtacattagtgtttcaggaggtcatcttggaatctccaaaagtgatatgaagaagcatgtagtgccttacttgacaagttcagcatcgccaacaaatggaaacaatgaggtgaatggacttcaacgtaaggttgtgggatgcaaaaaggagcctgtatga

Protein Analysis

75

Amino Acids

8.22

Weight (kDa)

8.82

Isoelectric Point (pI)

31.05

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 164
AfaI GTAC 2 cut(s) 17, 71
AfiI CCNNNNNNNGG 1 cut(s) 164
AgsI TTSAA 2 cut(s) 23, 191
AjuI GAANNNNNNNTTGG 2 cut(s) 15, 47
AluBI AGCT 1 cut(s) 56
AluI AGCT 1 cut(s) 56
AsuHPI GGTGA 1 cut(s) 190
BbsI GAAGAC 1 cut(s) 30
BmiI GGNNCC 1 cut(s) 219
BmsI GCATC 2 cut(s) 161, 197
BpiI GAAGAC 1 cut(s) 30
Bsc4I CCNNNNNNNGG 1 cut(s) 164
Bse1I ACTGG 1 cut(s) 32
BseGI GGATG 2 cut(s) 55, 212
BseLI CCNNNNNNNGG 1 cut(s) 164
BseNI ACTGG 1 cut(s) 32
BslI CCNNNNNNNGG 1 cut(s) 164
Bsp1407I TGTACA 1 cut(s) 15
Bsp143I GATC 1 cut(s) 10
BspLI GGNNCC 1 cut(s) 219
BsrGI TGTACA 1 cut(s) 15
BsrI ACTGG 1 cut(s) 32
BssMI GATC 1 cut(s) 10
BstAPI GCANNNNNTGC 1 cut(s) 130
BstAUI TGTACA 1 cut(s) 15
BstF5I GGATG 2 cut(s) 55, 212
BstKTI GATC 1 cut(s) 13
BstMBI GATC 1 cut(s) 10
BstMWI GCNNNNNNNGC 1 cut(s) 130
BstNSI RCATGY 1 cut(s) 128
BstV2I GAAGAC 1 cut(s) 30
BtgZI GCGATG 1 cut(s) 138
BtsCI GGATG 2 cut(s) 55, 212
Csp6I GTAC 2 cut(s) 16, 70
CviAII CATG 1 cut(s) 125
CviJI RGCY 2 cut(s) 56, 220
CviKI_1 RGCY 2 cut(s) 56, 220
CviQI GTAC 2 cut(s) 16, 70
DpnI GATC 1 cut(s) 12
DpnII GATC 1 cut(s) 10
FaeI CATG 1 cut(s) 128
FaiI YATR 3 cut(s) 116, 126, 226
FatI CATG 1 cut(s) 124
FokI GGATG 2 cut(s) 62, 219
Hin1II CATG 1 cut(s) 128
HinfI GANTC 1 cut(s) 99
HphI GGTGA 1 cut(s) 190
Hpy188III TCNNGA 1 cut(s) 84
HpyAV CCTTC 1 cut(s) 54
HpyCH4IV ACGT 1 cut(s) 193
HpyCH4V TGCA 2 cut(s) 4, 210
HpyF10VI GCNNNNNNNGC 1 cut(s) 130
HpySE526I ACGT 1 cut(s) 193
Hsp92II CATG 1 cut(s) 128
Kzo9I GATC 1 cut(s) 10
LmnI GCTCC 1 cut(s) 217
LpnPI CCDG 3 cut(s) 13, 42, 69
LweI GCATC 2 cut(s) 161, 197
MaeII ACGT 1 cut(s) 193
MalI GATC 1 cut(s) 12
MboI GATC 1 cut(s) 10
MboII GAAGA 2 cut(s) 35, 130
MnlI CCTC 2 cut(s) 80, 169
MwoI GCNNNNNNNGC 1 cut(s) 130
NdeII GATC 1 cut(s) 10
NlaIII CATG 1 cut(s) 128
NlaIV GGNNCC 1 cut(s) 219
NspI RCATGY 1 cut(s) 128
PfeI GAWTC 1 cut(s) 99
PflMI CCANNNNNTGG 1 cut(s) 164
PspN4I GGNNCC 1 cut(s) 219
RsaI GTAC 2 cut(s) 17, 71
RsaNI GTAC 2 cut(s) 16, 70
Sau3AI GATC 1 cut(s) 10
SetI ASST 5 cut(s) 58, 91, 180, 196, 201
SfaNI GCATC 2 cut(s) 161, 197
SgeI CNNG 8 cut(s) 40, 69, 79, 96, 107, 137, 151, 156
TaiI ACGT 1 cut(s) 196
TatI WGTACW 2 cut(s) 15, 69
TfiI GAWTC 1 cut(s) 99
TspDTI ATGAA 2 cut(s) 66, 131
Van91I CCANNNNNTGG 1 cut(s) 164
XceI RCATGY 1 cut(s) 128
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.