Rh2BG022900

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2B
OG0003705
Physical Location & Seq
Forward (+)
1540350 .. 1540669
320 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2BG022900.1

Sequence Viewer

Length: 246 bp
ATGATCGGAGAGCACGACGTTGAAATAGAACCCCTCGTTGCGCTCGGAAAATTTGAGGCCGATGAAGGCGTGCTTGTCGGTGCCGTCCTCGATCTTAAGGACGAATTAGCTCGACGAGTCGAGCACGGTCTCGATGGAGGTCGCTGGAGTTCGGATCCTCAAGTCGGATCTCGCACTGGTCGATTGATTTGTGGTATCAATGATCGCGGTGGTGAAGATGTTGACAAAGTTCGAGACGAAGAGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

81

Amino Acids

8.8

Weight (kDa)

4.49

Isoelectric Point (pI)

30.53

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 80
AccII CGCG 1 cut(s) 207
AciI CCGC 1 cut(s) 207
AclWI GGATC 3 cut(s) 149, 162, 175
AcsI RAATTY 1 cut(s) 50
AfiI CCNNNNNNNGG 1 cut(s) 164
AflII CTTAAG 1 cut(s) 95
AgsI TTSAA 1 cut(s) 23
AluBI AGCT 1 cut(s) 110
AluI AGCT 1 cut(s) 110
Alw21I GWGCWC 2 cut(s) 15, 126
Alw26I GTCTC 2 cut(s) 134, 228
AlwI GGATC 3 cut(s) 149, 162, 175
AoxI GGCC 1 cut(s) 57
ApoI RAATTY 1 cut(s) 50
AspLEI GCGC 1 cut(s) 43
AsuHPI GGTGA 1 cut(s) 224
BamHI GGATCC 1 cut(s) 154
BanI GGYRCC 1 cut(s) 80
Bbv12I GWGCWC 2 cut(s) 15, 126
BccI CCATC 1 cut(s) 128
BceAI ACGGC 1 cut(s) 68
BcoDI GTCTC 2 cut(s) 134, 228
BfrI CTTAAG 1 cut(s) 95
BmiI GGNNCC 2 cut(s) 82, 156
BpmI CTGGAG 1 cut(s) 166
BpuEI CTTGAG 1 cut(s) 144
BsaI GGTCTC 1 cut(s) 134
Bsc4I CCNNNNNNNGG 1 cut(s) 164
Bse1I ACTGG 1 cut(s) 181
BseLI CCNNNNNNNGG 1 cut(s) 164
BseNI ACTGG 1 cut(s) 181
Bsh1236I CGCG 1 cut(s) 207
BshFI GGCC 1 cut(s) 59
BshNI GGYRCC 1 cut(s) 80
BsiHKAI GWGCWC 2 cut(s) 15, 126
BslI CCNNNNNNNGG 1 cut(s) 164
BsmAI GTCTC 2 cut(s) 134, 228
BsmBI CGTCTC 1 cut(s) 228
BsnI GGCC 1 cut(s) 59
Bso31I GGTCTC 1 cut(s) 134
Bsp1286I GDGCHC 2 cut(s) 15, 126
Bsp143I GATC 5 cut(s) 3, 91, 154, 167, 202
BspACI CCGC 1 cut(s) 207
BspANI GGCC 1 cut(s) 59
BspFNI CGCG 1 cut(s) 207
BspLI GGNNCC 2 cut(s) 82, 156
BspPI GGATC 3 cut(s) 149, 162, 175
BspT107I GGYRCC 1 cut(s) 80
BspTI CTTAAG 1 cut(s) 95
BspTNI GGTCTC 1 cut(s) 134
BsrI ACTGG 1 cut(s) 181
BssMI GATC 5 cut(s) 3, 91, 154, 167, 202
Bst4CI ACNGT 1 cut(s) 128
Bst6I CTCTTC 1 cut(s) 234
BstAFI CTTAAG 1 cut(s) 95
BstC8I GCNNGC 1 cut(s) 71
BstFNI CGCG 1 cut(s) 207
BstHHI GCGC 1 cut(s) 43
BstKTI GATC 5 cut(s) 6, 94, 157, 170, 205
BstMAI GTCTC 2 cut(s) 134, 228
BstMBI GATC 5 cut(s) 3, 91, 154, 167, 202
BstUI CGCG 1 cut(s) 207
BstX2I RGATCY 2 cut(s) 154, 167
BstYI RGATCY 2 cut(s) 154, 167
BsuRI GGCC 1 cut(s) 59
BtsIMutI CAGTG 1 cut(s) 174
Cac8I GCNNGC 1 cut(s) 71
CfoI GCGC 1 cut(s) 43
CviJI RGCY 2 cut(s) 59, 110
CviKI_1 RGCY 2 cut(s) 59, 110
DpnI GATC 5 cut(s) 5, 93, 156, 169, 204
DpnII GATC 5 cut(s) 3, 91, 154, 167, 202
Eam1104I CTCTTC 1 cut(s) 234
EarI CTCTTC 1 cut(s) 234
Eco31I GGTCTC 1 cut(s) 134
Esp3I CGTCTC 1 cut(s) 228
FalI AAGNNNNNCTT 2 cut(s) 57, 89
GlaI GCGC 1 cut(s) 42
GsuI CTGGAG 1 cut(s) 166
HaeIII GGCC 1 cut(s) 59
HhaI GCGC 1 cut(s) 43
Hin6I GCGC 1 cut(s) 41
HinP1I GCGC 1 cut(s) 41
HincII GTYRAC 1 cut(s) 223
HindII GTYRAC 1 cut(s) 223
HinfI GANTC 1 cut(s) 117
HphI GGTGA 1 cut(s) 224
Hpy166II GTNNAC 1 cut(s) 223
Hpy188I TCNGA 4 cut(s) 8, 47, 154, 167
Hpy188III TCNNGA 2 cut(s) 131, 233
Hpy8I GTNNAC 1 cut(s) 223
Hpy99I CGWCG 2 cut(s) 20, 117
HpyAV CCTTC 1 cut(s) 59
HpyCH4III ACNGT 1 cut(s) 128
HpyCH4IV ACGT 1 cut(s) 18
HpySE526I ACGT 1 cut(s) 18
HspAI GCGC 1 cut(s) 41
Kzo9I GATC 5 cut(s) 3, 91, 154, 167, 202
LpnPI CCDG 2 cut(s) 130, 162
MaeII ACGT 1 cut(s) 18
MalI GATC 5 cut(s) 5, 93, 156, 169, 204
MboI GATC 5 cut(s) 3, 91, 154, 167, 202
MboII GAAGA 1 cut(s) 227
MflI RGATCY 2 cut(s) 154, 167
MhlI GDGCHC 2 cut(s) 15, 126
MluCI AATT 2 cut(s) 50, 104
MlyI GAGTC 1 cut(s) 126
MmeI TCCRAC 1 cut(s) 145
MnlI CCTC 5 cut(s) 44, 49, 98, 131, 168
MseI TTAA 1 cut(s) 96
MspCI CTTAAG 1 cut(s) 95
MvnI CGCG 1 cut(s) 207
NdeII GATC 5 cut(s) 3, 91, 154, 167, 202
NlaIV GGNNCC 2 cut(s) 82, 156
PcsI WCGNNNNNNNCGW 2 cut(s) 12, 178
PleI GAGTC 1 cut(s) 125
PpsI GAGTC 1 cut(s) 125
PspN4I GGNNCC 2 cut(s) 82, 156
PsuI RGATCY 2 cut(s) 154, 167
SaqAI TTAA 1 cut(s) 96
Sau3AI GATC 5 cut(s) 3, 91, 154, 167, 202
SchI GAGTC 1 cut(s) 126
SduI GDGCHC 2 cut(s) 15, 126
SetI ASST 3 cut(s) 21, 112, 142
SmlI CTYRAG 2 cut(s) 95, 159
SmoI CTYRAG 2 cut(s) 95, 159
Sse9I AATT 2 cut(s) 50, 104
SsiI CCGC 1 cut(s) 207
TaaI ACNGT 1 cut(s) 128
TaiI ACGT 1 cut(s) 21
TaqI TCGA 6 cut(s) 90, 112, 120, 132, 181, 232
TasI AATT 2 cut(s) 50, 104
Tru1I TTAA 1 cut(s) 96
Tru9I TTAA 1 cut(s) 96
TscAI CASTG 1 cut(s) 181
TspDTI ATGAA 1 cut(s) 78
TspRI CASTG 1 cut(s) 181
Vha464I CTTAAG 1 cut(s) 95
XapI RAATTY 1 cut(s) 50
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.