Rh1CG177600

ABC transporter F family member

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1C
Physical Location & Seq
Reverse (-)
39200940 .. 39203005
2066 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1CG177600.1

Sequence Viewer

Length: 234 bp
ATGGAGGGTAAAAGGGGAAAAGGCAACCATAAGCTCAGACTTATTGGAAGAAATGCTACTGGAAAAACAACATTTCTTAGGCACTTGGCTATGCATGCCATTGATAGCATTCACCAAGTATTGCACGTGGAGCAAGAAGTGGTAGGTGATGATACATCAGCCTTGAAATGTGTTGTTAAAACTGATACTGAAAGAACCCAGCTTTTGGAAGAAAAAGATCATCTCCTTGCTTAA

Protein Analysis

77

Amino Acids

8.64

Weight (kDa)

7.98

Isoelectric Point (pI)

32.93

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 205
AcvI CACGTG 1 cut(s) 127
AfiI CCNNNNNNNGG 1 cut(s) 205
AgsI TTSAA 1 cut(s) 166
AluBI AGCT 2 cut(s) 34, 202
AluI AGCT 2 cut(s) 34, 202
AsuHPI GGTGA 2 cut(s) 104, 158
BarI GAAGNNNNNNTAC 2 cut(s) 40, 72
BbrPI CACGTG 1 cut(s) 127
BsaAI YACGTR 1 cut(s) 127
Bsc4I CCNNNNNNNGG 1 cut(s) 205
Bse1I ACTGG 1 cut(s) 64
BseLI CCNNNNNNNGG 1 cut(s) 205
BseMII CTCAG 1 cut(s) 49
BseNI ACTGG 1 cut(s) 64
BseYI CCCAGC 1 cut(s) 198
BslI CCNNNNNNNGG 1 cut(s) 205
BsmI GAATGC 1 cut(s) 108
Bsp143I GATC 1 cut(s) 217
BspCNI CTCAG 1 cut(s) 48
BsrI ACTGG 1 cut(s) 64
BssMI GATC 1 cut(s) 217
BstBAI YACGTR 1 cut(s) 127
BstC8I GCNNGC 1 cut(s) 96
BstDEI CTNAG 2 cut(s) 35, 77
BstKTI GATC 1 cut(s) 220
BstMBI GATC 1 cut(s) 217
BstMWI GCNNNNNNNGC 2 cut(s) 95, 130
BstNSI RCATGY 1 cut(s) 98
Cac8I GCNNGC 1 cut(s) 96
CviAII CATG 1 cut(s) 95
CviJI RGCY 4 cut(s) 34, 89, 161, 202
CviKI_1 RGCY 4 cut(s) 34, 89, 161, 202
DdeI CTNAG 2 cut(s) 35, 77
DpnI GATC 1 cut(s) 219
DpnII GATC 1 cut(s) 217
Eco72I CACGTG 1 cut(s) 127
EcoT22I ATGCAT 1 cut(s) 96
FaeI CATG 1 cut(s) 98
FaiI YATR 3 cut(s) 30, 92, 96
FatI CATG 1 cut(s) 94
GsaI CCCAGC 1 cut(s) 202
Hin1II CATG 1 cut(s) 98
HphI GGTGA 2 cut(s) 104, 158
Hpy188I TCNGA 1 cut(s) 38
HpyCH4IV ACGT 1 cut(s) 126
HpyCH4V TGCA 2 cut(s) 94, 124
HpyF10VI GCNNNNNNNGC 2 cut(s) 95, 130
HpyF3I CTNAG 2 cut(s) 35, 77
HpySE526I ACGT 1 cut(s) 126
Hsp92II CATG 1 cut(s) 98
Kzo9I GATC 1 cut(s) 217
LmnI GCTCC 1 cut(s) 130
LpnPI CCDG 2 cut(s) 45, 212
MaeII ACGT 1 cut(s) 126
MalI GATC 1 cut(s) 219
MboI GATC 1 cut(s) 217
MboII GAAGA 2 cut(s) 60, 221
Mph1103I ATGCAT 1 cut(s) 96
MseI TTAA 2 cut(s) 177, 232
Mva1269I GAATGC 1 cut(s) 108
MwoI GCNNNNNNNGC 2 cut(s) 95, 130
NdeII GATC 1 cut(s) 217
NlaIII CATG 1 cut(s) 98
NsiI ATGCAT 1 cut(s) 96
NspI RCATGY 1 cut(s) 98
PaeI GCATGC 1 cut(s) 98
PctI GAATGC 1 cut(s) 108
PflMI CCANNNNNTGG 1 cut(s) 205
PmaCI CACGTG 1 cut(s) 127
PmlI CACGTG 1 cut(s) 127
Ppu21I YACGTR 1 cut(s) 127
PspCI CACGTG 1 cut(s) 127
PspFI CCCAGC 1 cut(s) 198
SaqAI TTAA 2 cut(s) 177, 232
Sau3AI GATC 1 cut(s) 217
SetI ASST 4 cut(s) 36, 129, 148, 204
SgeI CNNG 9 cut(s) 72, 97, 107, 128, 137, 139, 146, 175, 211
SphI GCATGC 1 cut(s) 98
TaiI ACGT 1 cut(s) 129
Tru1I TTAA 2 cut(s) 177, 232
Tru9I TTAA 2 cut(s) 177, 232
Van91I CCANNNNNTGG 1 cut(s) 205
XceI RCATGY 1 cut(s) 98
Zsp2I ATGCAT 1 cut(s) 96
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.