Rmu_sc0000089.1_g000002

Belongs to the eukaryotic initiation factor 4E family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000089.1
Physical Location & Seq
Reverse (-)
5083 .. 7286
2204 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000089.1_g000002.1.cds

Sequence Viewer

Length: 684 bp
atggcggtggaagacgcttcagcttcggaagatcagagcaagacggagtcgaaccctaaatcaatgcaagacgagaacgagctggaagaaggagagatcgtcggcggcgacgaggtgtcttcgaagatcgcaaagccgctgcaccaccctctggagcactcatggaccttctggttcgatagcccctcggccaagaactccaagcccaagcaagaggattggggcagctctattcgcccgatctacaccttctctactgttgaggaattctggggtatatacaataatatacgccatccaagcaagttgtctatggggacggacctccattgtttcaaaaacaaaattgagcctaagtgggaggatcctgtttgtgctaatggagggaaatggactctaacttttactaaagggaaatctgatcatccctggctgcatacgttgctagcactgattggggaacagtttgatcatggagatgaaatatgtggagcagttgtcaatgtcagaagtaggcaagaaaaaattgctatttggaccaagaatgcagcaaatgaggctgctcagttgagcattggaaaacaatggaagggctttctggataacaacgaagctataggcttcatatttcatgacgatgcaaggcgacaggagagaggtgccaagaatagatacacagtgtga

Protein Analysis

227

Amino Acids

25.73

Weight (kDa)

5.61

Isoelectric Point (pI)

40.07

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 659
AccB7I CCANNNNNTGG 1 cut(s) 151
AciI CCGC 3 cut(s) 5, 105, 137
AclWI GGATC 2 cut(s) 359, 372
AcoI YGGCCR 1 cut(s) 189
AcsI RAATTY 1 cut(s) 266
AdeI CACNNNGTG 1 cut(s) 681
AfiI CCNNNNNNNGG 1 cut(s) 151
AgsI TTSAA 1 cut(s) 337
AhdI GACNNNNNGTC 1 cut(s) 115
AjnI CCWGG 1 cut(s) 428
AluBI AGCT 4 cut(s) 23, 82, 228, 614
AluI AGCT 4 cut(s) 23, 82, 228, 614
Alw21I GWGCWC 1 cut(s) 159
AlwI GGATC 2 cut(s) 359, 372
AoxI GGCC 1 cut(s) 189
ApeKI GCWGC 5 cut(s) 139, 225, 433, 548, 560
ApoI RAATTY 1 cut(s) 266
AspS9I GGNCC 3 cut(s) 165, 322, 537
AsuII TTCGAA 1 cut(s) 122
AsuNHI GCTAGC 1 cut(s) 445
AvaII GGWCC 3 cut(s) 165, 322, 537
BamHI GGATCC 1 cut(s) 364
BanI GGYRCC 1 cut(s) 659
BbsI GAAGAC 2 cut(s) 18, 111
Bbv12I GWGCWC 1 cut(s) 159
BbvI GCAGC 5 cut(s) 126, 237, 420, 547, 560
BccI CCATC 1 cut(s) 303
BciT130I CCWGG 1 cut(s) 430
BclI TGATCA 2 cut(s) 421, 469
BfaI CTAG 1 cut(s) 446
BfmI CTRYAG 1 cut(s) 615
BisI GCNGC 7 cut(s) 106, 137, 140, 226, 434, 549, 561
BlsI GCNGC 7 cut(s) 107, 138, 141, 227, 435, 550, 562
Bme1390I CCNGG 1 cut(s) 430
Bme18I GGWCC 3 cut(s) 165, 322, 537
BmeRI GACNNNNNGTC 1 cut(s) 115
BmgT120I GGNCC 3 cut(s) 165, 322, 537
BmiI GGNNCC 2 cut(s) 366, 661
BmrFI CCNGG 1 cut(s) 430
BmsI GCATC 1 cut(s) 628
BmtI GCTAGC 1 cut(s) 449
BpiI GAAGAC 2 cut(s) 18, 111
BpmI CTGGAG 1 cut(s) 173
Bpu14I TTCGAA 1 cut(s) 122
BsaJI CCNNGG 2 cut(s) 186, 428
BsaXI ACNNNNNCTCC 4 cut(s) 84, 114, 483, 513
Bsc4I CCNNNNNNNGG 1 cut(s) 151
BseBI CCWGG 1 cut(s) 430
BseDI CCNNGG 2 cut(s) 186, 428
BseGI GGATG 2 cut(s) 295, 424
BseLI CCNNNNNNNGG 1 cut(s) 151
BseMII CTCAG 1 cut(s) 578
BseXI GCAGC 5 cut(s) 126, 237, 420, 547, 560
BsgI GTGCAG 1 cut(s) 125
BshFI GGCC 1 cut(s) 191
BshNI GGYRCC 1 cut(s) 659
BsiHKAI GWGCWC 1 cut(s) 159
BslFI GGGAC 1 cut(s) 331
BslI CCNNNNNNNGG 1 cut(s) 151
BsmFI GGGAC 1 cut(s) 331
BsmI GAATGC 1 cut(s) 550
BsnI GGCC 1 cut(s) 191
Bsp119I TTCGAA 1 cut(s) 122
Bsp1286I GDGCHC 1 cut(s) 159
Bsp143I GATC 7 cut(s) 31, 96, 126, 240, 364, 421, 469
BspACI CCGC 3 cut(s) 5, 105, 137
BspANI GGCC 1 cut(s) 191
BspCNI CTCAG 1 cut(s) 577
BspHI TCATGA 1 cut(s) 631
BspLI GGNNCC 2 cut(s) 366, 661
BspOI GCTAGC 1 cut(s) 449
BspPI GGATC 2 cut(s) 359, 372
BspT104I TTCGAA 1 cut(s) 122
BspT107I GGYRCC 1 cut(s) 659
BssECI CCNNGG 2 cut(s) 186, 428
BssMI GATC 7 cut(s) 31, 96, 126, 240, 364, 421, 469
Bst2UI CCWGG 1 cut(s) 430
Bst4CI ACNGT 3 cut(s) 259, 465, 679
BstAPI GCANNNNNTGC 1 cut(s) 442
BstBI TTCGAA 1 cut(s) 122
BstC8I GCNNGC 1 cut(s) 447
BstDEI CTNAG 2 cut(s) 354, 564
BstF5I GGATG 2 cut(s) 295, 424
BstKTI GATC 7 cut(s) 34, 99, 129, 243, 367, 424, 472
BstMBI GATC 7 cut(s) 31, 96, 126, 240, 364, 421, 469
BstMWI GCNNNNNNNGC 4 cut(s) 234, 300, 442, 557
BstNI CCWGG 1 cut(s) 430
BstSCI CCNGG 1 cut(s) 428
BstSFI CTRYAG 1 cut(s) 615
BstV1I GCAGC 5 cut(s) 126, 237, 420, 547, 560
BstV2I GAAGAC 2 cut(s) 18, 111
BstX2I RGATCY 1 cut(s) 364
BstYI RGATCY 1 cut(s) 364
BsuRI GGCC 1 cut(s) 191
BtsCI GGATG 2 cut(s) 295, 424
BtsIMutI CAGTG 2 cut(s) 449, 684
Cac8I GCNNGC 1 cut(s) 447
CciI TCATGA 1 cut(s) 631
Cfr13I GGNCC 3 cut(s) 165, 322, 537
CseI GACGC 1 cut(s) 23
CviAII CATG 3 cut(s) 162, 473, 632
DdeI CTNAG 2 cut(s) 354, 564
DpnI GATC 7 cut(s) 33, 98, 128, 242, 366, 423, 471
DpnII GATC 7 cut(s) 31, 96, 126, 240, 364, 421, 469
DraIII CACNNNGTG 1 cut(s) 681
DriI GACNNNNNGTC 1 cut(s) 115
EaeI YGGCCR 1 cut(s) 189
Eam1105I GACNNNNNGTC 1 cut(s) 115
Eco47I GGWCC 3 cut(s) 165, 322, 537
EcoRI GAATTC 1 cut(s) 266
EcoRII CCWGG 1 cut(s) 428
FaeI CATG 3 cut(s) 165, 476, 635
FaqI GGGAC 1 cut(s) 331
FatI CATG 3 cut(s) 161, 472, 631
FbaI TGATCA 2 cut(s) 421, 469
Fnu4HI GCNGC 7 cut(s) 106, 137, 140, 226, 434, 549, 561
FokI GGATG 2 cut(s) 282, 411
Fsp4HI GCNGC 7 cut(s) 106, 137, 140, 226, 434, 549, 561
FspBI CTAG 1 cut(s) 446
GluI GCNGC 7 cut(s) 106, 137, 140, 226, 434, 549, 561
GsuI CTGGAG 1 cut(s) 173
HaeIII GGCC 1 cut(s) 191
HgaI GACGC 1 cut(s) 23
Hin1II CATG 3 cut(s) 165, 476, 635
HinfI GANTC 2 cut(s) 47, 394
Hpy188I TCNGA 4 cut(s) 28, 36, 421, 509
Hpy188III TCNNGA 3 cut(s) 152, 599, 632
Hpy99I CGWCG 2 cut(s) 104, 113
HpyAV CCTTC 4 cut(s) 83, 178, 259, 583
HpyCH4III ACNGT 3 cut(s) 259, 465, 679
HpyCH4IV ACGT 1 cut(s) 440
HpyCH4V TGCA 5 cut(s) 67, 142, 436, 548, 641
HpyF10VI GCNNNNNNNGC 4 cut(s) 234, 300, 442, 557
HpyF3I CTNAG 2 cut(s) 354, 564
HpySE526I ACGT 1 cut(s) 440
Hsp92II CATG 3 cut(s) 165, 476, 635
Ksp22I TGATCA 2 cut(s) 421, 469
Kzo9I GATC 7 cut(s) 31, 96, 126, 240, 364, 421, 469
LmnI GCTCC 2 cut(s) 154, 491
LpnPI CCDG 9 cut(s) 68, 137, 157, 256, 381, 415, 442, 584, 635
Lsp1109I GCAGC 5 cut(s) 126, 237, 420, 547, 560
LweI GCATC 1 cut(s) 628
MaeI CTAG 1 cut(s) 446
MaeII ACGT 1 cut(s) 440
MalI GATC 7 cut(s) 33, 98, 128, 242, 366, 423, 471
MboI GATC 7 cut(s) 31, 96, 126, 240, 364, 421, 469
MboII GAAGA 5 cut(s) 23, 41, 98, 111, 136
MflI RGATCY 1 cut(s) 364
MhlI GDGCHC 1 cut(s) 159
MluCI AATT 3 cut(s) 266, 345, 525
MlyI GAGTC 2 cut(s) 56, 388
MslI CAYNNNNRTG 2 cut(s) 477, 636
MspA1I CMGCKG 1 cut(s) 139
MspR9I CCNGG 1 cut(s) 430
Mva1269I GAATGC 1 cut(s) 550
MvaI CCWGG 1 cut(s) 430
MwoI GCNNNNNNNGC 4 cut(s) 234, 300, 442, 557
NdeII GATC 7 cut(s) 31, 96, 126, 240, 364, 421, 469
NheI GCTAGC 1 cut(s) 445
NlaIII CATG 3 cut(s) 165, 476, 635
NlaIV GGNNCC 2 cut(s) 366, 661
NmeAIII GCCGAG 1 cut(s) 167
NspV TTCGAA 1 cut(s) 122
PagI TCATGA 1 cut(s) 631
PcsI WCGNNNNNNNCGW 2 cut(s) 105, 108
PctI GAATGC 1 cut(s) 550
PflFI GACNNNGTC 1 cut(s) 46
PflMI CCANNNNNTGG 1 cut(s) 151
PkrI GCNGC 7 cut(s) 107, 138, 141, 227, 435, 550, 562
PleI GAGTC 2 cut(s) 55, 388
PpsI GAGTC 2 cut(s) 55, 388
Psp6I CCWGG 1 cut(s) 428
PspGI CCWGG 1 cut(s) 428
PspN4I GGNNCC 2 cut(s) 366, 661
PspPI GGNCC 3 cut(s) 165, 322, 537
PsuI RGATCY 1 cut(s) 364
PsyI GACNNNGTC 1 cut(s) 46
RseI CAYNNNNRTG 2 cut(s) 477, 636
SatI GCNGC 7 cut(s) 106, 137, 140, 226, 434, 549, 561
Sau3AI GATC 7 cut(s) 31, 96, 126, 240, 364, 421, 469
Sau96I GGNCC 3 cut(s) 165, 322, 537
SchI GAGTC 2 cut(s) 56, 388
ScrFI CCNGG 1 cut(s) 430
SduI GDGCHC 1 cut(s) 159
SfaNI GCATC 1 cut(s) 628
SfcI CTRYAG 1 cut(s) 615
SfuI TTCGAA 1 cut(s) 122
SinI GGWCC 3 cut(s) 165, 322, 537
SmiMI CAYNNNNRTG 2 cut(s) 477, 636
Sse9I AATT 3 cut(s) 266, 345, 525
SsiI CCGC 3 cut(s) 5, 105, 137
SspMI CTAG 1 cut(s) 446
StyD4I CCNGG 1 cut(s) 428
TaaI ACNGT 3 cut(s) 259, 465, 679
TaiI ACGT 1 cut(s) 443
TaqI TCGA 3 cut(s) 50, 122, 177
TasI AATT 3 cut(s) 266, 345, 525
TauI GCSGC 2 cut(s) 108, 139
TscAI CASTG 2 cut(s) 456, 684
TseI GCWGC 5 cut(s) 139, 225, 433, 548, 560
TspDTI ATGAA 3 cut(s) 495, 613, 620
TspGWI ACGGA 2 cut(s) 59, 335
TspRI CASTG 2 cut(s) 456, 684
Tth111I GACNNNGTC 1 cut(s) 46
Van91I CCANNNNNTGG 1 cut(s) 151
VpaK11BI GGWCC 3 cut(s) 165, 322, 537
XapI RAATTY 1 cut(s) 266
XspI CTAG 1 cut(s) 446
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.