Rmu_sc0006811.1_g000012

Belongs to the eukaryotic initiation factor 4E family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0006811.1
Physical Location & Seq
Forward (+)
43819 .. 44952
1134 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0006811.1_g000012.1.cds

Sequence Viewer

Length: 372 bp
atggggacggacctccattgtttcaaaaacaaaattgagcctaagtgggaggatcctgtttgtgctaatggagggaaatggactctaacttttactaaagggaaatctgatcatccctggctgcatacgttgctagcactgattggggaacagtttgatcatggagatgaaatatgtggagcagttgtcaatgtcagaagtaggcaagaaaaaattgctatttggaccaagaatgcagcaaatgaggctgctcagttgagcattggaaaacaatggaagggctttctggataacaacgaagctataggcttcatatttcatgacgatgcaaggcgacaggagagaggtgccaagaatagatacacagtgtga

Protein Analysis

123

Amino Acids

13.95

Weight (kDa)

7.76

Isoelectric Point (pI)

28.3

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 347
AclWI GGATC 2 cut(s) 47, 60
AdeI CACNNNGTG 1 cut(s) 369
AgsI TTSAA 1 cut(s) 25
AjnI CCWGG 1 cut(s) 116
AluBI AGCT 1 cut(s) 302
AluI AGCT 1 cut(s) 302
AlwI GGATC 2 cut(s) 47, 60
ApeKI GCWGC 3 cut(s) 121, 236, 248
AspS9I GGNCC 2 cut(s) 10, 225
AsuNHI GCTAGC 1 cut(s) 133
AvaII GGWCC 2 cut(s) 10, 225
BamHI GGATCC 1 cut(s) 52
BanI GGYRCC 1 cut(s) 347
BbvI GCAGC 3 cut(s) 108, 235, 248
BciT130I CCWGG 1 cut(s) 118
BclI TGATCA 2 cut(s) 109, 157
BfaI CTAG 1 cut(s) 134
BfmI CTRYAG 1 cut(s) 303
BisI GCNGC 3 cut(s) 122, 237, 249
BlsI GCNGC 3 cut(s) 123, 238, 250
Bme1390I CCNGG 1 cut(s) 118
Bme18I GGWCC 2 cut(s) 10, 225
BmgT120I GGNCC 2 cut(s) 10, 225
BmiI GGNNCC 2 cut(s) 54, 349
BmrFI CCNGG 1 cut(s) 118
BmsI GCATC 1 cut(s) 316
BmtI GCTAGC 1 cut(s) 137
BsaJI CCNNGG 1 cut(s) 116
BsaXI ACNNNNNCTCC 2 cut(s) 171, 201
BseBI CCWGG 1 cut(s) 118
BseDI CCNNGG 1 cut(s) 116
BseGI GGATG 1 cut(s) 112
BseMII CTCAG 1 cut(s) 266
BseXI GCAGC 3 cut(s) 108, 235, 248
BshNI GGYRCC 1 cut(s) 347
BslFI GGGAC 1 cut(s) 19
BsmFI GGGAC 1 cut(s) 19
BsmI GAATGC 1 cut(s) 238
Bsp143I GATC 3 cut(s) 52, 109, 157
BspCNI CTCAG 1 cut(s) 265
BspHI TCATGA 1 cut(s) 319
BspLI GGNNCC 2 cut(s) 54, 349
BspOI GCTAGC 1 cut(s) 137
BspPI GGATC 2 cut(s) 47, 60
BspT107I GGYRCC 1 cut(s) 347
BssECI CCNNGG 1 cut(s) 116
BssMI GATC 3 cut(s) 52, 109, 157
Bst2UI CCWGG 1 cut(s) 118
Bst4CI ACNGT 2 cut(s) 153, 367
BstAPI GCANNNNNTGC 1 cut(s) 130
BstC8I GCNNGC 1 cut(s) 135
BstDEI CTNAG 2 cut(s) 42, 252
BstF5I GGATG 1 cut(s) 112
BstKTI GATC 3 cut(s) 55, 112, 160
BstMBI GATC 3 cut(s) 52, 109, 157
BstMWI GCNNNNNNNGC 2 cut(s) 130, 245
BstNI CCWGG 1 cut(s) 118
BstSCI CCNGG 1 cut(s) 116
BstSFI CTRYAG 1 cut(s) 303
BstV1I GCAGC 3 cut(s) 108, 235, 248
BstX2I RGATCY 1 cut(s) 52
BstYI RGATCY 1 cut(s) 52
BtsCI GGATG 1 cut(s) 112
BtsIMutI CAGTG 2 cut(s) 137, 372
Cac8I GCNNGC 1 cut(s) 135
CciI TCATGA 1 cut(s) 319
Cfr13I GGNCC 2 cut(s) 10, 225
CviAII CATG 2 cut(s) 161, 320
CviJI RGCY 6 cut(s) 40, 121, 248, 282, 302, 309
CviKI_1 RGCY 6 cut(s) 40, 121, 248, 282, 302, 309
DdeI CTNAG 2 cut(s) 42, 252
DpnI GATC 3 cut(s) 54, 111, 159
DpnII GATC 3 cut(s) 52, 109, 157
DraIII CACNNNGTG 1 cut(s) 369
Eco47I GGWCC 2 cut(s) 10, 225
EcoRII CCWGG 1 cut(s) 116
FaeI CATG 2 cut(s) 164, 323
FaiI YATR 6 cut(s) 126, 162, 175, 305, 314, 321
FaqI GGGAC 1 cut(s) 19
FatI CATG 2 cut(s) 160, 319
FbaI TGATCA 2 cut(s) 109, 157
Fnu4HI GCNGC 3 cut(s) 122, 237, 249
FokI GGATG 1 cut(s) 99
Fsp4HI GCNGC 3 cut(s) 122, 237, 249
FspBI CTAG 1 cut(s) 134
GluI GCNGC 3 cut(s) 122, 237, 249
Hin1II CATG 2 cut(s) 164, 323
HinfI GANTC 1 cut(s) 82
Hpy188I TCNGA 2 cut(s) 109, 197
Hpy188III TCNNGA 2 cut(s) 287, 320
HpyAV CCTTC 1 cut(s) 271
HpyCH4III ACNGT 2 cut(s) 153, 367
HpyCH4IV ACGT 1 cut(s) 128
HpyCH4V TGCA 3 cut(s) 124, 236, 329
HpyF10VI GCNNNNNNNGC 2 cut(s) 130, 245
HpyF3I CTNAG 2 cut(s) 42, 252
HpySE526I ACGT 1 cut(s) 128
Hsp92II CATG 2 cut(s) 164, 323
Ksp22I TGATCA 2 cut(s) 109, 157
Kzo9I GATC 3 cut(s) 52, 109, 157
LmnI GCTCC 1 cut(s) 179
LpnPI CCDG 5 cut(s) 69, 103, 130, 272, 323
Lsp1109I GCAGC 3 cut(s) 108, 235, 248
LweI GCATC 1 cut(s) 316
MaeI CTAG 1 cut(s) 134
MaeII ACGT 1 cut(s) 128
MalI GATC 3 cut(s) 54, 111, 159
MboI GATC 3 cut(s) 52, 109, 157
MflI RGATCY 1 cut(s) 52
MluCI AATT 2 cut(s) 33, 213
MlyI GAGTC 1 cut(s) 76
MnlI CCTC 5 cut(s) 23, 43, 65, 238, 338
MslI CAYNNNNRTG 2 cut(s) 165, 324
MspR9I CCNGG 1 cut(s) 118
Mva1269I GAATGC 1 cut(s) 238
MvaI CCWGG 1 cut(s) 118
MwoI GCNNNNNNNGC 2 cut(s) 130, 245
NdeII GATC 3 cut(s) 52, 109, 157
NheI GCTAGC 1 cut(s) 133
NlaIII CATG 2 cut(s) 164, 323
NlaIV GGNNCC 2 cut(s) 54, 349
PagI TCATGA 1 cut(s) 319
PctI GAATGC 1 cut(s) 238
PkrI GCNGC 3 cut(s) 123, 238, 250
PleI GAGTC 1 cut(s) 76
PpsI GAGTC 1 cut(s) 76
Psp6I CCWGG 1 cut(s) 116
PspGI CCWGG 1 cut(s) 116
PspN4I GGNNCC 2 cut(s) 54, 349
PspPI GGNCC 2 cut(s) 10, 225
PsuI RGATCY 1 cut(s) 52
RseI CAYNNNNRTG 2 cut(s) 165, 324
SatI GCNGC 3 cut(s) 122, 237, 249
Sau3AI GATC 3 cut(s) 52, 109, 157
Sau96I GGNCC 2 cut(s) 10, 225
SchI GAGTC 1 cut(s) 76
ScrFI CCNGG 1 cut(s) 118
SetI ASST 4 cut(s) 15, 131, 304, 349
SfaNI GCATC 1 cut(s) 316
SfcI CTRYAG 1 cut(s) 303
SinI GGWCC 2 cut(s) 10, 225
SmiMI CAYNNNNRTG 2 cut(s) 165, 324
Sse9I AATT 2 cut(s) 33, 213
SspMI CTAG 1 cut(s) 134
StyD4I CCNGG 1 cut(s) 116
TaaI ACNGT 2 cut(s) 153, 367
TaiI ACGT 1 cut(s) 131
TasI AATT 2 cut(s) 33, 213
TscAI CASTG 2 cut(s) 144, 372
TseI GCWGC 3 cut(s) 121, 236, 248
TspDTI ATGAA 3 cut(s) 183, 301, 308
TspGWI ACGGA 1 cut(s) 23
TspRI CASTG 2 cut(s) 144, 372
VpaK11BI GGWCC 2 cut(s) 10, 225
XspI CTAG 1 cut(s) 134
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.