Rh1BG202600

eukaryotic translation initiation factor

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1B
Physical Location & Seq
Reverse (-)
32010718 .. 32016234
5517 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1BG202600.1

Sequence Viewer

Length: 234 bp
ATGCCACTTTACTTTTCAAGCAAAATAAGCCTTCCACTAAATCAAGTATATTCTTTACTCTTTACAAGTTCCACATATCTCACTTCTACTCAAACAAATGAGGCTGCTCAGGTGAGCATTGGAAAACAGTGGAAGGGCATTCTGGAGAGCAACGAAACTATAGGGAGGCATCGAGTGTCTTACTTAACTGGCTTCAATGGCCCTAGAAGCTTCAAGGTGTTAACTCACCCTTGA

Protein Analysis

77

Amino Acids

8.64

Weight (kDa)

9.77

Isoelectric Point (pI)

20.64

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 3 cut(s) 18, 196, 214
AluBI AGCT 1 cut(s) 210
AluI AGCT 1 cut(s) 210
AoxI GGCC 1 cut(s) 199
ApeKI GCWGC 1 cut(s) 104
AspS9I GGNCC 1 cut(s) 200
AsuHPI GGTGA 2 cut(s) 124, 218
BbvI GCAGC 1 cut(s) 91
BfaI CTAG 1 cut(s) 204
BfmI CTRYAG 1 cut(s) 159
BisI GCNGC 1 cut(s) 105
BlsI GCNGC 1 cut(s) 106
BmgT120I GGNCC 1 cut(s) 200
BmsI GCATC 1 cut(s) 178
BpmI CTGGAG 1 cut(s) 164
Bpu10I CCTNAGC 1 cut(s) 108
Bse1I ACTGG 1 cut(s) 193
BseMII CTCAG 1 cut(s) 122
BseNI ACTGG 1 cut(s) 193
BseXI GCAGC 1 cut(s) 91
BshFI GGCC 1 cut(s) 201
BsmI GAATGC 1 cut(s) 138
BsnI GGCC 1 cut(s) 201
BspANI GGCC 1 cut(s) 201
BspCNI CTCAG 1 cut(s) 121
BsrI ACTGG 1 cut(s) 193
Bst4CI ACNGT 1 cut(s) 129
BstDEI CTNAG 1 cut(s) 108
BstMWI GCNNNNNNNGC 3 cut(s) 27, 198, 207
BstSFI CTRYAG 1 cut(s) 159
BstV1I GCAGC 1 cut(s) 91
BsuRI GGCC 1 cut(s) 201
BtsIMutI CAGTG 1 cut(s) 134
Cfr13I GGNCC 1 cut(s) 200
CviJI RGCY 5 cut(s) 30, 104, 192, 201, 210
CviKI_1 RGCY 5 cut(s) 30, 104, 192, 201, 210
DdeI CTNAG 1 cut(s) 108
FaiI YATR 3 cut(s) 49, 76, 161
Fnu4HI GCNGC 1 cut(s) 105
Fsp4HI GCNGC 1 cut(s) 105
FspBI CTAG 1 cut(s) 204
GluI GCNGC 1 cut(s) 105
GsuI CTGGAG 1 cut(s) 164
HaeIII GGCC 1 cut(s) 201
HincII GTYRAC 1 cut(s) 222
HindII GTYRAC 1 cut(s) 222
HindIII AAGCTT 1 cut(s) 208
HpaI GTTAAC 1 cut(s) 222
HphI GGTGA 2 cut(s) 124, 218
Hpy166II GTNNAC 1 cut(s) 222
Hpy188III TCNNGA 1 cut(s) 143
Hpy8I GTNNAC 1 cut(s) 222
HpyAV CCTTC 2 cut(s) 41, 127
HpyCH4III ACNGT 1 cut(s) 129
HpyF10VI GCNNNNNNNGC 3 cut(s) 27, 198, 207
HpyF3I CTNAG 1 cut(s) 108
KspAI GTTAAC 1 cut(s) 222
LpnPI CCDG 3 cut(s) 95, 128, 174
Lsp1109I GCAGC 1 cut(s) 91
LweI GCATC 1 cut(s) 178
MaeI CTAG 1 cut(s) 204
MnlI CCTC 2 cut(s) 94, 159
MseI TTAA 2 cut(s) 185, 221
Mva1269I GAATGC 1 cut(s) 138
MwoI GCNNNNNNNGC 3 cut(s) 27, 198, 207
PctI GAATGC 1 cut(s) 138
PkrI GCNGC 1 cut(s) 106
PspPI GGNCC 1 cut(s) 200
SaqAI TTAA 2 cut(s) 185, 221
SatI GCNGC 1 cut(s) 105
Sau96I GGNCC 1 cut(s) 200
SetI ASST 3 cut(s) 114, 212, 219
SfaNI GCATC 1 cut(s) 178
SfcI CTRYAG 1 cut(s) 159
SgeI CNNG 9 cut(s) 30, 56, 78, 122, 155, 185, 201, 216, 226
SspMI CTAG 1 cut(s) 204
TaaI ACNGT 1 cut(s) 129
TaqI TCGA 1 cut(s) 172
Tru1I TTAA 2 cut(s) 185, 221
Tru9I TTAA 2 cut(s) 185, 221
TscAI CASTG 1 cut(s) 134
TseI GCWGC 1 cut(s) 104
TspRI CASTG 1 cut(s) 134
XspI CTAG 1 cut(s) 204
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.