Rmu_sc0000441.1_g000027

VQ motif

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000441.1
Physical Location & Seq
Reverse (-)
94761 .. 95405
645 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000441.1_g000027.1.cds

Sequence Viewer

Length: 645 bp
atggatttttcagactacccaacaggcaagtctccaagaagagagctccaactccagggtccacgtccaacacctctcaagattcacaaagattcccacaagatcaagaagccaccgattgttcctcaaccctcgcaacctaatcagcctcaccagccgcctcgacaaccggttataatctacacagtctcgccgaagatcattcacacaaaccctagcgacttcatgaacctcgtccaacgcctcaccggattacctcgctccaattcttctgcttcttgttcttcctcgtctcctcgaaatgatcaaaacactaatggaggcggtggtgaatcgacaatggagcagtctaggtcgtcggatcatgaaggaatcatggacatggatgatgatgatcgtgatcgtgatgctggtgtgaagcagcaaaagggtttgtttccggggatcttgtcgccagctccgggttcgcttcctccgattccttcaaacttcttctctccgccggcggatagcttcttccatgatttgagcccggtacttcatggtaacaggaacttcatagaaggtagctacatgcctagtccgtccaacttcttttcccctactccgtccattgacttattcaacaatttttccgatttatag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

214

Amino Acids

23.56

Weight (kDa)

6.36

Isoelectric Point (pI)

73.14

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 176
AciI CCGC 4 cut(s) 158, 324, 500, 506
AclWI GGATC 2 cut(s) 369, 452
AfaI GTAC 1 cut(s) 537
AfiI CCNNNNNNNGG 2 cut(s) 55, 461
AgeI ACCGGT 1 cut(s) 169
AgsI TTSAA 2 cut(s) 486, 625
AjiI CACGTC 1 cut(s) 65
AjnI CCWGG 1 cut(s) 54
AluBI AGCT 4 cut(s) 46, 458, 513, 570
AluI AGCT 4 cut(s) 46, 458, 513, 570
Alw21I GWGCWC 1 cut(s) 48
Alw26I GTCTC 3 cut(s) 36, 193, 297
AlwI GGATC 2 cut(s) 369, 452
ApeKI GCWGC 1 cut(s) 421
AsiGI ACCGGT 1 cut(s) 169
AspS9I GGNCC 1 cut(s) 59
AsuC2I CCSGG 3 cut(s) 441, 462, 533
AsuHPI GGTGA 3 cut(s) 143, 238, 341
AvaII GGWCC 1 cut(s) 59
BanII GRGCYC 2 cut(s) 48, 533
Bbv12I GWGCWC 1 cut(s) 48
BbvI GCAGC 1 cut(s) 433
BciT130I CCWGG 1 cut(s) 56
BclI TGATCA 1 cut(s) 304
BcnI CCSGG 3 cut(s) 441, 462, 533
BcoDI GTCTC 3 cut(s) 36, 193, 297
BfaI CTAG 3 cut(s) 216, 351, 579
BisI GCNGC 2 cut(s) 158, 422
BlsI GCNGC 2 cut(s) 159, 423
Bme1390I CCNGG 4 cut(s) 56, 441, 462, 533
Bme18I GGWCC 1 cut(s) 59
BmgBI CACGTC 1 cut(s) 65
BmgT120I GGNCC 1 cut(s) 59
BmiI GGNNCC 1 cut(s) 60
BmrFI CCNGG 4 cut(s) 56, 441, 462, 533
BmsI GCATC 1 cut(s) 397
BpmI CTGGAG 1 cut(s) 38
BpuEI CTTGAG 1 cut(s) 62
BpuMI CCSGG 3 cut(s) 441, 462, 533
BsaBI GATNNNNATC 2 cut(s) 393, 399
BsaJI CCNNGG 2 cut(s) 55, 440
BsaWI WCCGGW 2 cut(s) 169, 248
Bsc4I CCNNNNNNNGG 2 cut(s) 55, 461
Bse118I RCCGGY 2 cut(s) 169, 502
Bse8I GATNNNNATC 2 cut(s) 393, 399
BseBI CCWGG 1 cut(s) 56
BseDI CCNNGG 2 cut(s) 55, 440
BseGI GGATG 1 cut(s) 391
BseJI GATNNNNATC 2 cut(s) 393, 399
BseLI CCNNNNNNNGG 2 cut(s) 55, 461
BseRI GAGGAG 1 cut(s) 285
BseXI GCAGC 1 cut(s) 433
BshTI ACCGGT 1 cut(s) 169
BsiHKAI GWGCWC 1 cut(s) 48
BsiSI CCGG 6 cut(s) 170, 249, 440, 461, 503, 533
BslI CCNNNNNNNGG 2 cut(s) 55, 461
BsmAI GTCTC 3 cut(s) 36, 193, 297
BsmBI CGTCTC 1 cut(s) 297
Bsp1286I GDGCHC 2 cut(s) 48, 533
Bsp143I GATC 7 cut(s) 102, 198, 304, 361, 394, 400, 444
BspACI CCGC 4 cut(s) 158, 324, 500, 506
BspHI TCATGA 2 cut(s) 225, 364
BspLI GGNNCC 1 cut(s) 60
BspPI GGATC 2 cut(s) 369, 452
BsrFI RCCGGY 2 cut(s) 169, 502
BssAI RCCGGY 2 cut(s) 169, 502
BssECI CCNNGG 2 cut(s) 55, 440
BssMI GATC 7 cut(s) 102, 198, 304, 361, 394, 400, 444
Bst2UI CCWGG 1 cut(s) 56
Bst4CI ACNGT 1 cut(s) 187
Bst6I CTCTTC 1 cut(s) 34
BstC8I GCNNGC 2 cut(s) 456, 504
BstF5I GGATG 1 cut(s) 391
BstKTI GATC 7 cut(s) 105, 201, 307, 364, 397, 403, 447
BstMAI GTCTC 3 cut(s) 36, 193, 297
BstMBI GATC 7 cut(s) 102, 198, 304, 361, 394, 400, 444
BstMWI GCNNNNNNNGC 1 cut(s) 154
BstNI CCWGG 1 cut(s) 56
BstNSI RCATGY 1 cut(s) 577
BstSCI CCNGG 4 cut(s) 54, 439, 460, 531
BstV1I GCAGC 1 cut(s) 433
BstX2I RGATCY 1 cut(s) 444
BstYI RGATCY 1 cut(s) 444
BtrI CACGTC 1 cut(s) 65
BtsCI GGATG 1 cut(s) 391
Cac8I GCNNGC 2 cut(s) 456, 504
CciI TCATGA 2 cut(s) 225, 364
Cfr10I RCCGGY 2 cut(s) 169, 502
Cfr13I GGNCC 1 cut(s) 59
Csp6I GTAC 1 cut(s) 536
CspAI ACCGGT 1 cut(s) 169
CviAII CATG 7 cut(s) 226, 365, 376, 382, 521, 542, 574
CviJI RGCY 8 cut(s) 46, 112, 148, 157, 458, 513, 531, 570
CviKI_1 RGCY 8 cut(s) 46, 112, 148, 157, 458, 513, 531, 570
CviQI GTAC 1 cut(s) 536
DpnI GATC 7 cut(s) 104, 200, 306, 363, 396, 402, 446
DpnII GATC 7 cut(s) 102, 198, 304, 361, 394, 400, 444
Eam1104I CTCTTC 1 cut(s) 34
EarI CTCTTC 1 cut(s) 34
EciI GGCGGA 2 cut(s) 489, 521
Ecl136II GAGCTC 1 cut(s) 46
Eco24I GRGCYC 2 cut(s) 48, 533
Eco47I GGWCC 1 cut(s) 59
Eco53kI GAGCTC 1 cut(s) 46
EcoICRI GAGCTC 1 cut(s) 46
EcoRII CCWGG 1 cut(s) 54
EcoT38I GRGCYC 2 cut(s) 48, 533
Esp3I CGTCTC 1 cut(s) 297
FaeI CATG 7 cut(s) 229, 368, 379, 385, 524, 545, 577
FatI CATG 7 cut(s) 225, 364, 375, 381, 520, 541, 573
FbaI TGATCA 1 cut(s) 304
Fnu4HI GCNGC 2 cut(s) 158, 422
FokI GGATG 1 cut(s) 398
FriOI GRGCYC 2 cut(s) 48, 533
Fsp4HI GCNGC 2 cut(s) 158, 422
FspBI CTAG 3 cut(s) 216, 351, 579
GluI GCNGC 2 cut(s) 158, 422
GsuI CTGGAG 1 cut(s) 38
HapII CCGG 6 cut(s) 170, 249, 440, 461, 503, 533
Hin1II CATG 7 cut(s) 229, 368, 379, 385, 524, 545, 577
HinfI GANTC 5 cut(s) 82, 92, 332, 372, 478
HpaII CCGG 6 cut(s) 170, 249, 440, 461, 503, 533
HphI GGTGA 3 cut(s) 143, 238, 341
Hpy166II GTNNAC 1 cut(s) 62
Hpy188I TCNGA 4 cut(s) 13, 361, 477, 637
Hpy188III TCNNGA 6 cut(s) 79, 106, 226, 365, 398, 404
Hpy8I GTNNAC 1 cut(s) 62
Hpy99I CGWCG 1 cut(s) 361
HpyAV CCTTC 3 cut(s) 362, 492, 557
HpyCH4III ACNGT 1 cut(s) 187
HpyCH4IV ACGT 1 cut(s) 64
HpyF10VI GCNNNNNNNGC 1 cut(s) 154
HpySE526I ACGT 1 cut(s) 64
Hsp92II CATG 7 cut(s) 229, 368, 379, 385, 524, 545, 577
KroI GCCGGC 1 cut(s) 502
KroNI GCCGGC 1 cut(s) 504
Ksp22I TGATCA 1 cut(s) 304
Kzo9I GATC 7 cut(s) 102, 198, 304, 361, 394, 400, 444
LmnI GCTCC 4 cut(s) 51, 266, 343, 463
Lsp1109I GCAGC 1 cut(s) 433
LweI GCATC 1 cut(s) 397
MaeI CTAG 3 cut(s) 216, 351, 579
MaeII ACGT 1 cut(s) 64
MaeIII GTNAC 1 cut(s) 545
MalI GATC 7 cut(s) 104, 200, 306, 363, 396, 402, 446
MboI GATC 7 cut(s) 102, 198, 304, 361, 394, 400, 444
MboII GAAGA 6 cut(s) 51, 208, 261, 276, 484, 508
MflI RGATCY 1 cut(s) 444
MhlI GDGCHC 2 cut(s) 48, 533
MluCI AATT 2 cut(s) 265, 628
MmeI TCCRAC 5 cut(s) 73, 92, 262, 339, 612
MreI CGCCGGCG 1 cut(s) 502
MroNI GCCGGC 1 cut(s) 502
MslI CAYNNNNRTG 1 cut(s) 380
MspI CCGG 6 cut(s) 170, 249, 440, 461, 503, 533
MspR9I CCNGG 4 cut(s) 56, 441, 462, 533
MvaI CCWGG 1 cut(s) 56
MwoI GCNNNNNNNGC 1 cut(s) 154
NaeI GCCGGC 1 cut(s) 504
NciI CCSGG 3 cut(s) 441, 462, 533
NdeII GATC 7 cut(s) 102, 198, 304, 361, 394, 400, 444
NgoMIV GCCGGC 1 cut(s) 502
NlaIII CATG 7 cut(s) 229, 368, 379, 385, 524, 545, 577
NlaIV GGNNCC 1 cut(s) 60
NspI RCATGY 1 cut(s) 577
PagI TCATGA 2 cut(s) 225, 364
PcsI WCGNNNNNNNCGW 1 cut(s) 473
PdiI GCCGGC 1 cut(s) 504
PfeI GAWTC 5 cut(s) 82, 92, 332, 372, 478
PinAI ACCGGT 1 cut(s) 169
PkrI GCNGC 2 cut(s) 159, 423
PsiI TTATAA 1 cut(s) 176
Psp124BI GAGCTC 1 cut(s) 48
Psp6I CCWGG 1 cut(s) 54
PspGI CCWGG 1 cut(s) 54
PspN4I GGNNCC 1 cut(s) 60
PspPI GGNCC 1 cut(s) 59
PsuI RGATCY 1 cut(s) 444
RsaI GTAC 1 cut(s) 537
RsaNI GTAC 1 cut(s) 536
RseI CAYNNNNRTG 1 cut(s) 380
SacI GAGCTC 1 cut(s) 48
SatI GCNGC 2 cut(s) 158, 422
Sau3AI GATC 7 cut(s) 102, 198, 304, 361, 394, 400, 444
Sau96I GGNCC 1 cut(s) 59
ScrFI CCNGG 4 cut(s) 56, 441, 462, 533
SduI GDGCHC 2 cut(s) 48, 533
SfaNI GCATC 1 cut(s) 397
SgrAI CRCCGGYG 1 cut(s) 502
SinI GGWCC 1 cut(s) 59
SmiMI CAYNNNNRTG 1 cut(s) 380
SmlI CTYRAG 1 cut(s) 77
SmoI CTYRAG 1 cut(s) 77
Sse9I AATT 2 cut(s) 265, 628
SsiI CCGC 4 cut(s) 158, 324, 500, 506
SspMI CTAG 3 cut(s) 216, 351, 579
SstI GAGCTC 1 cut(s) 48
StyD4I CCNGG 4 cut(s) 54, 439, 460, 531
TaaI ACNGT 1 cut(s) 187
TaiI ACGT 1 cut(s) 67
TaqI TCGA 3 cut(s) 163, 298, 335
TasI AATT 2 cut(s) 265, 628
TauI GCSGC 1 cut(s) 160
TfiI GAWTC 5 cut(s) 82, 92, 332, 372, 478
TseI GCWGC 1 cut(s) 421
TspDTI ATGAA 5 cut(s) 214, 242, 381, 530, 547
TspGWI ACGGA 2 cut(s) 573, 597
VpaK11BI GGWCC 1 cut(s) 59
XceI RCATGY 1 cut(s) 577
XspI CTAG 3 cut(s) 216, 351, 579
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.