Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0000487.1

Orthogroup ID

OG0003070

Physical Location & Seq

Genomic Coordinates Reverse (-)

210844 .. 212561

Gene Structure 1718 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0000487.1_g000052.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 639 bp

atgactttgggctttatctgtcaccgtgggataggcatggctggagatacgctcaggagtgaccatttgtggacgtattgggctccaaaggatggtgacaaagaggagcattggattgaatttagaggcagagataaagataaaggattgaggttcaatgtgattaggattcaagaggcaatcgggcttggccagagaatcaaaaggcatgaaatttatgtggatggtaagagggttgcaaatggaaccactgtgggcaacttagctgaaagatgcttcatcaaagtgagtagccaaagaggtggcaaaggaggaggttttggacctgaaaatgtgctagacagtgaccatttgtggacgtattgggctccaaaggatggtgacaaagaggagcattggattgaatttagaggcagagataaagataaaggattgaggttcaatgtgattaggattcaagaggcaatcgggcttggccagagaatcaaaaggcatgaaatttatgtggatggtaagaggtttgcaaatggaaccactgtggggtacaagaggcttcacagaattgaagggggagtagtctatggccaaattgtcagaattagaattaaagactcaaaagggctgcctttgatttcttga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0004553 GO:0004560 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005773 GO:0006516 GO:0006807 GO:0008150 GO:0008152 GO:0009056 GO:0009057 GO:0009100 GO:0009987 GO:0015928 GO:0016787 GO:0016798 GO:0019538 GO:0030163 GO:0043170 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044237 GO:0044238 GO:0044248 GO:0044260 GO:0044265 GO:0044424 GO:0044444 GO:0044464 GO:0071704 GO:1901135 GO:1901136 GO:1901564 GO:1901565 GO:1901575

KEGG Pathways

Metabolic & Signaling

ko00511 map00511

Pfam Domains

Protein Families

Alpha_L_fucos F5_F8_type_C

Protein Analysis

212

Amino Acids

24.25

Weight (kDa)

9.74

Isoelectric Point (pI)

29.8

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0003070)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_7g28480 FvH4_7g28490
malus_domestica	MD01G1188500.v1.1 MD01G1188600.v1.1
prunus_persica	Prupe.2G285300_v2.0.a1
pyrus_communis	pycom01g20020 pycom01g20030
rosa_chinensis	RchiOBHm_Chr1g0375771 RchiOBHm_Chr1g0375821 RchiOBHm_Chr1g0375841 RchiOBHm_Chr1g0375871
rosa_laevigata	RLG00000026648 RLG00000026649 RLG00000026652 RLG00000026654
rosa_multiflora	Rmu_sc0000487.1_g000052 Rmu_sc0001943.1_g000004 Rmu_sc0001943.1_g000006 Rmu_sc0001943.1_g000007
rosa_roxburghii	Rroxscaffold_4G00282570 Rroxscaffold_4G00282610 Rroxscaffold_4G00282640
rosa_rugosa	Rorug01G0391800 Rorug01G0391900 Rorug01G0392000
rosa_samantha	Rh1AG403600 Rh1AG403700 Rh1AG403800 Rh1BG367200 Rh1BG367300 Rh1CG379800 Rh1CG380000 Rh1CG380100 Rh1DG397200 Rh1DG397300
rosa_wichuraiana	Rw0G000980 Rw0G023580 Rw4G005900

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB7I	CCANNNNNTGG	2 cut(s)	92, 377
AcoI	YGGCCR	3 cut(s)	190, 475, 583
AcsI	RAATTY	4 cut(s)	119, 213, 404, 498
AfaI	GTAC	1 cut(s)	545
AfiI	CCNNNNNNNGG	3 cut(s)	92, 377, 540
AgsI	TTSAA	7 cut(s)	119, 157, 173, 404, 442, 458, 566
AluBI	AGCT	1 cut(s)	266
AluI	AGCT	1 cut(s)	266
AoxI	GGCC	3 cut(s)	190, 475, 583
ApeKI	GCWGC	1 cut(s)	622
ApoI	RAATTY	4 cut(s)	119, 213, 404, 498
AspS9I	GGNCC	1 cut(s)	323
AsuHPI	GGTGA	3 cut(s)	14, 107, 392
AvaII	GGWCC	1 cut(s)	323
BalI	TGGCCA	3 cut(s)	192, 477, 585
BanII	GRGCYC	2 cut(s)	85, 370
BbvI	GCAGC	1 cut(s)	609
BccI	CCATC	4 cut(s)	86, 218, 371, 503
BfaI	CTAG	1 cut(s)	338
BisI	GCNGC	1 cut(s)	623
BlsI	GCNGC	1 cut(s)	624
Bme18I	GGWCC	1 cut(s)	323
BmgT120I	GGNCC	1 cut(s)	323
BmiI	GGNNCC	4 cut(s)	84, 247, 369, 532
BmsI	GCATC	1 cut(s)	263
BplI	GAGNNNNNCTC	2 cut(s)	36, 68
BpmI	CTGGAG	1 cut(s)	63
Bpu10I	CCTNAGC	1 cut(s)	53
BsaJI	CCNNGG	1 cut(s)	25
Bsc4I	CCNNNNNNNGG	3 cut(s)	92, 377, 540
BseDI	CCNNGG	1 cut(s)	25
BseGI	GGATG	4 cut(s)	97, 229, 382, 514
BseLI	CCNNNNNNNGG	3 cut(s)	92, 377, 540
BseMII	CTCAG	1 cut(s)	67
BseRI	GAGGAG	3 cut(s)	119, 327, 404
BseXI	GCAGC	1 cut(s)	609
BshFI	GGCC	3 cut(s)	192, 477, 585
BslI	CCNNNNNNNGG	3 cut(s)	92, 377, 540
BsnI	GGCC	3 cut(s)	192, 477, 585
Bsp1286I	GDGCHC	2 cut(s)	85, 370
BspANI	GGCC	3 cut(s)	192, 477, 585
BspCNI	CTCAG	1 cut(s)	66
BspLI	GGNNCC	4 cut(s)	84, 247, 369, 532
BssECI	CCNNGG	1 cut(s)	25
Bst4CI	ACNGT	4 cut(s)	26, 253, 344, 538
BstDEI	CTNAG	2 cut(s)	53, 262
BstDSI	CCRYGG	1 cut(s)	25
BstF5I	GGATG	4 cut(s)	97, 229, 382, 514
BstV1I	GCAGC	1 cut(s)	609
BstXI	CCANNNNNNTGG	1 cut(s)	302
BsuRI	GGCC	3 cut(s)	192, 477, 585
BtgI	CCRYGG	1 cut(s)	25
BtsCI	GGATG	4 cut(s)	97, 229, 382, 514
BtsIMutI	CAGTG	3 cut(s)	249, 349, 534
Cfr13I	GGNCC	1 cut(s)	323
Csp6I	GTAC	1 cut(s)	544
CviAII	CATG	3 cut(s)	37, 209, 494
CviQI	GTAC	1 cut(s)	544
DdeI	CTNAG	2 cut(s)	53, 262
EaeI	YGGCCR	3 cut(s)	190, 475, 583
Eco24I	GRGCYC	2 cut(s)	85, 370
Eco47I	GGWCC	1 cut(s)	323
EcoT38I	GRGCYC	2 cut(s)	85, 370
FaeI	CATG	3 cut(s)	40, 212, 497
FaiI	YATR	6 cut(s)	38, 210, 219, 495, 504, 582
FatI	CATG	3 cut(s)	36, 208, 493
Fnu4HI	GCNGC	1 cut(s)	623
FokI	GGATG	4 cut(s)	104, 236, 389, 521
FriOI	GRGCYC	2 cut(s)	85, 370
Fsp4HI	GCNGC	1 cut(s)	623
FspBI	CTAG	1 cut(s)	338
GluI	GCNGC	1 cut(s)	623
GsuI	CTGGAG	1 cut(s)	63
HaeIII	GGCC	3 cut(s)	192, 477, 585
Hin1II	CATG	3 cut(s)	40, 212, 497
HinfI	GANTC	5 cut(s)	169, 198, 454, 483, 611
HphI	GGTGA	3 cut(s)	14, 107, 392
Hpy166II	GTNNAC	2 cut(s)	72, 357
Hpy188I	TCNGA	1 cut(s)	596
Hpy188III	TCNNGA	4 cut(s)	55, 173, 458, 636
Hpy8I	GTNNAC	2 cut(s)	72, 357
HpyAV	CCTTC	1 cut(s)	560
HpyCH4III	ACNGT	4 cut(s)	26, 253, 344, 538
HpyCH4IV	ACGT	2 cut(s)	74, 359
HpyCH4V	TGCA	2 cut(s)	239, 524
HpyF3I	CTNAG	2 cut(s)	53, 262
HpySE526I	ACGT	2 cut(s)	74, 359
Hsp92II	CATG	3 cut(s)	40, 212, 497
LmnI	GCTCC	4 cut(s)	88, 106, 373, 391
LpnPI	CCDG	5 cut(s)	27, 40, 206, 339, 491
Lsp1109I	GCAGC	1 cut(s)	609
LweI	GCATC	1 cut(s)	263
MaeI	CTAG	1 cut(s)	338
MaeII	ACGT	2 cut(s)	74, 359
MaeIII	GTNAC	5 cut(s)	20, 59, 95, 344, 380
MhlI	GDGCHC	2 cut(s)	85, 370
MlsI	TGGCCA	3 cut(s)	192, 477, 585
MluCI	AATT	8 cut(s)	119, 213, 404, 498, 561, 588, 597, 603
MluNI	TGGCCA	3 cut(s)	192, 477, 585
MlyI	GAGTC	1 cut(s)	605
Mox20I	TGGCCA	3 cut(s)	192, 477, 585
MscI	TGGCCA	3 cut(s)	192, 477, 585
MseI	TTAA	1 cut(s)	606
MslI	CAYNNNNRTG	1 cut(s)	284
Msp20I	TGGCCA	3 cut(s)	192, 477, 585
NlaIII	CATG	3 cut(s)	40, 212, 497
NlaIV	GGNNCC	4 cut(s)	84, 247, 369, 532
NmuCI	GTSAC	5 cut(s)	20, 59, 95, 344, 380
PfeI	GAWTC	4 cut(s)	169, 198, 454, 483
PflMI	CCANNNNNTGG	2 cut(s)	92, 377
PkrI	GCNGC	1 cut(s)	624
PleI	GAGTC	1 cut(s)	605
PpsI	GAGTC	1 cut(s)	605
PspN4I	GGNNCC	4 cut(s)	84, 247, 369, 532
PspPI	GGNCC	1 cut(s)	323
RsaI	GTAC	1 cut(s)	545
RsaNI	GTAC	1 cut(s)	544
RseI	CAYNNNNRTG	1 cut(s)	284
SaqAI	TTAA	1 cut(s)	606
SatI	GCNGC	1 cut(s)	623
Sau96I	GGNCC	1 cut(s)	323
SchI	GAGTC	1 cut(s)	605
SduI	GDGCHC	2 cut(s)	85, 370
SetI	ASST	9 cut(s)	77, 155, 268, 304, 319, 328, 362, 440, 521
SfaNI	GCATC	1 cut(s)	263
SinI	GGWCC	1 cut(s)	323
SmiMI	CAYNNNNRTG	1 cut(s)	284
Sse9I	AATT	8 cut(s)	119, 213, 404, 498, 561, 588, 597, 603
SspMI	CTAG	1 cut(s)	338
TaaI	ACNGT	4 cut(s)	26, 253, 344, 538
TaiI	ACGT	2 cut(s)	77, 362
TasI	AATT	8 cut(s)	119, 213, 404, 498, 561, 588, 597, 603
TfiI	GAWTC	4 cut(s)	169, 198, 454, 483
Tru1I	TTAA	1 cut(s)	606
Tru9I	TTAA	1 cut(s)	606
TscAI	CASTG	3 cut(s)	256, 349, 541
TseFI	GTSAC	5 cut(s)	20, 59, 95, 344, 380
TseI	GCWGC	1 cut(s)	622
Tsp45I	GTSAC	5 cut(s)	20, 59, 95, 344, 380
TspDTI	ATGAA	3 cut(s)	225, 268, 510
TspRI	CASTG	3 cut(s)	256, 349, 541
Van91I	CCANNNNNTGG	2 cut(s)	92, 377
VpaK11BI	GGWCC	1 cut(s)	323
XapI	RAATTY	4 cut(s)	119, 213, 404, 498
XspI	CTAG	1 cut(s)	338

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.