Rmu_sc0000718.1_g000038

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000718.1
Physical Location & Seq
Forward (+)
150209 .. 152067
1859 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000718.1_g000038.1.cds

Sequence Viewer

Length: 444 bp
atggcggcggcaactgcagcagcagcttcaggaggccccaagctcctcctccggtgcaggcagtcctcctcttccgggcctgcaaacaacttcatggcctcttcaaaagctgccatccacatcccagattgcttttcttccacaggggccaaagtgtcttctcccatccgagctcttcaccctcgcagacgacaagaagaagaagaagcagaagagaattcaagcatcgttaacaacgccaccggtttcaactctcagaaggatttggaatatctggggaaggtgctagctggttccattgtgggtggagctgtaataaagtatggcagcatagtttttcctgagatagccagacccaacgtcatactggctcttattatgatattcactcctgtcattctagctactttacttctgatcaagcaaagtagtgcaaatggatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

147

Amino Acids

15.34

Weight (kDa)

9.34

Isoelectric Point (pI)

59.62

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 5, 8
AcsI RAATTY 1 cut(s) 217
AcuI CTGAAG 1 cut(s) 12
AfiI CCNNNNNNNGG 1 cut(s) 75
AgeI ACCGGT 1 cut(s) 242
AgsI TTSAA 3 cut(s) 105, 222, 250
AhdI GACNNNNNGTC 1 cut(s) 359
AluBI AGCT 7 cut(s) 26, 43, 110, 173, 290, 311, 404
AluI AGCT 7 cut(s) 26, 43, 110, 173, 290, 311, 404
Alw21I GWGCWC 1 cut(s) 175
AoxI GGCC 4 cut(s) 34, 77, 96, 147
ApeKI GCWGC 5 cut(s) 17, 20, 23, 110, 327
ApoI RAATTY 1 cut(s) 217
AsiGI ACCGGT 1 cut(s) 242
AspS9I GGNCC 3 cut(s) 35, 77, 147
AsuC2I CCSGG 1 cut(s) 76
AsuHPI GGTGA 1 cut(s) 170
AsuNHI GCTAGC 1 cut(s) 286
BanII GRGCYC 1 cut(s) 175
BbsI GAAGAC 1 cut(s) 150
Bbv12I GWGCWC 1 cut(s) 175
BbvI GCAGC 5 cut(s) 29, 32, 35, 97, 339
BccI CCATC 2 cut(s) 122, 173
BclI TGATCA 1 cut(s) 417
BcnI CCSGG 1 cut(s) 76
BfaI CTAG 2 cut(s) 287, 401
BfmI CTRYAG 1 cut(s) 15
BisI GCNGC 7 cut(s) 6, 9, 18, 21, 24, 111, 328
BlsI GCNGC 7 cut(s) 7, 10, 19, 22, 25, 112, 329
Bme1390I CCNGG 1 cut(s) 76
BmeRI GACNNNNNGTC 1 cut(s) 359
BmgT120I GGNCC 3 cut(s) 35, 77, 147
BmiI GGNNCC 3 cut(s) 37, 148, 295
BmrFI CCNGG 1 cut(s) 76
BmsI GCATC 1 cut(s) 234
BmtI GCTAGC 1 cut(s) 290
BpiI GAAGAC 1 cut(s) 150
BpuMI CCSGG 1 cut(s) 76
BsaWI WCCGGW 2 cut(s) 51, 242
Bsc4I CCNNNNNNNGG 1 cut(s) 75
Bse118I RCCGGY 1 cut(s) 242
Bse1I ACTGG 1 cut(s) 372
BseGI GGATG 3 cut(s) 114, 120, 165
BseLI CCNNNNNNNGG 1 cut(s) 75
BseMII CTCAG 2 cut(s) 269, 333
BseNI ACTGG 1 cut(s) 372
BseRI GAGGAG 3 cut(s) 35, 38, 58
BseXI GCAGC 5 cut(s) 29, 32, 35, 97, 339
BsgI GTGCAG 1 cut(s) 76
BshFI GGCC 4 cut(s) 36, 79, 98, 149
BshTI ACCGGT 1 cut(s) 242
BsiHKAI GWGCWC 1 cut(s) 175
BsiSI CCGG 3 cut(s) 52, 75, 243
BslI CCNNNNNNNGG 1 cut(s) 75
BsnI GGCC 4 cut(s) 36, 79, 98, 149
Bsp1286I GDGCHC 1 cut(s) 175
Bsp143I GATC 1 cut(s) 417
BspACI CCGC 2 cut(s) 5, 8
BspANI GGCC 4 cut(s) 36, 79, 98, 149
BspCNI CTCAG 2 cut(s) 268, 334
BspLI GGNNCC 3 cut(s) 37, 148, 295
BspMAI CTGCAG 1 cut(s) 19
BspOI GCTAGC 1 cut(s) 290
BspQI GCTCTTC 1 cut(s) 180
BsrFI RCCGGY 1 cut(s) 242
BsrI ACTGG 1 cut(s) 372
BssAI RCCGGY 1 cut(s) 242
BssMI GATC 1 cut(s) 417
Bst6I CTCTTC 4 cut(s) 76, 106, 180, 207
BstC8I GCNNGC 3 cut(s) 59, 81, 288
BstDEI CTNAG 2 cut(s) 255, 342
BstF5I GGATG 3 cut(s) 114, 120, 165
BstKTI GATC 1 cut(s) 420
BstMBI GATC 1 cut(s) 417
BstMWI GCNNNNNNNGC 3 cut(s) 14, 17, 23
BstSCI CCNGG 1 cut(s) 74
BstSFI CTRYAG 1 cut(s) 15
BstV1I GCAGC 5 cut(s) 29, 32, 35, 97, 339
BstV2I GAAGAC 1 cut(s) 150
BsuRI GGCC 4 cut(s) 36, 79, 98, 149
BtsCI GGATG 3 cut(s) 114, 120, 165
Cac8I GCNNGC 3 cut(s) 59, 81, 288
Cfr10I RCCGGY 1 cut(s) 242
Cfr13I GGNCC 3 cut(s) 35, 77, 147
CspAI ACCGGT 1 cut(s) 242
CviAII CATG 1 cut(s) 94
DdeI CTNAG 2 cut(s) 255, 342
DpnI GATC 1 cut(s) 419
DpnII GATC 1 cut(s) 417
DriI GACNNNNNGTC 1 cut(s) 359
Eam1104I CTCTTC 4 cut(s) 76, 106, 180, 207
Eam1105I GACNNNNNGTC 1 cut(s) 359
EarI CTCTTC 4 cut(s) 76, 106, 180, 207
Ecl136II GAGCTC 1 cut(s) 173
Eco24I GRGCYC 1 cut(s) 175
Eco53kI GAGCTC 1 cut(s) 173
Eco57I CTGAAG 1 cut(s) 12
EcoICRI GAGCTC 1 cut(s) 173
EcoO109I RGGNCCY 1 cut(s) 35
EcoRI GAATTC 1 cut(s) 217
EcoT38I GRGCYC 1 cut(s) 175
FaeI CATG 1 cut(s) 97
FaiI YATR 5 cut(s) 95, 324, 332, 365, 380
FatI CATG 1 cut(s) 93
FbaI TGATCA 1 cut(s) 417
Fnu4HI GCNGC 7 cut(s) 6, 9, 18, 21, 24, 111, 328
FokI GGATG 3 cut(s) 101, 107, 152
FriOI GRGCYC 1 cut(s) 175
Fsp4HI GCNGC 7 cut(s) 6, 9, 18, 21, 24, 111, 328
FspBI CTAG 2 cut(s) 287, 401
GluI GCNGC 7 cut(s) 6, 9, 18, 21, 24, 111, 328
HaeIII GGCC 4 cut(s) 36, 79, 98, 149
HapII CCGG 3 cut(s) 52, 75, 243
Hin1II CATG 1 cut(s) 97
HincII GTYRAC 1 cut(s) 232
HindII GTYRAC 1 cut(s) 232
HpaI GTTAAC 1 cut(s) 232
HpaII CCGG 3 cut(s) 52, 75, 243
HphI GGTGA 1 cut(s) 170
Hpy166II GTNNAC 1 cut(s) 232
Hpy188I TCNGA 3 cut(s) 170, 258, 417
Hpy188III TCNNGA 2 cut(s) 30, 341
Hpy8I GTNNAC 1 cut(s) 232
HpyAV CCTTC 2 cut(s) 253, 274
HpyCH4IV ACGT 1 cut(s) 360
HpyCH4V TGCA 4 cut(s) 17, 57, 83, 434
HpyF10VI GCNNNNNNNGC 3 cut(s) 14, 17, 23
HpyF3I CTNAG 2 cut(s) 255, 342
HpySE526I ACGT 1 cut(s) 360
Hsp92II CATG 1 cut(s) 97
Ksp22I TGATCA 1 cut(s) 417
KspAI GTTAAC 1 cut(s) 232
Kzo9I GATC 1 cut(s) 417
LguI GCTCTTC 1 cut(s) 180
LmnI GCTCC 2 cut(s) 48, 308
Lsp1109I GCAGC 5 cut(s) 29, 32, 35, 97, 339
LweI GCATC 1 cut(s) 234
MaeI CTAG 2 cut(s) 287, 401
MaeII ACGT 1 cut(s) 360
MalI GATC 1 cut(s) 419
MboI GATC 1 cut(s) 417
MboII GAAGA 9 cut(s) 63, 93, 129, 150, 167, 209, 212, 215, 224
MhlI GDGCHC 1 cut(s) 175
MluCI AATT 1 cut(s) 217
MnlI CCTC 7 cut(s) 26, 56, 59, 76, 79, 109, 192
MseI TTAA 1 cut(s) 231
MspI CCGG 3 cut(s) 52, 75, 243
MspR9I CCNGG 1 cut(s) 76
MwoI GCNNNNNNNGC 3 cut(s) 14, 17, 23
NciI CCSGG 1 cut(s) 76
NdeII GATC 1 cut(s) 417
NheI GCTAGC 1 cut(s) 286
NlaIII CATG 1 cut(s) 97
NlaIV GGNNCC 3 cut(s) 37, 148, 295
PciSI GCTCTTC 1 cut(s) 180
PinAI ACCGGT 1 cut(s) 242
PkrI GCNGC 7 cut(s) 7, 10, 19, 22, 25, 112, 329
Psp124BI GAGCTC 1 cut(s) 175
PspN4I GGNNCC 3 cut(s) 37, 148, 295
PspPI GGNCC 3 cut(s) 35, 77, 147
PstI CTGCAG 1 cut(s) 19
SacI GAGCTC 1 cut(s) 175
SapI GCTCTTC 1 cut(s) 180
SaqAI TTAA 1 cut(s) 231
SatI GCNGC 7 cut(s) 6, 9, 18, 21, 24, 111, 328
Sau3AI GATC 1 cut(s) 417
Sau96I GGNCC 3 cut(s) 35, 77, 147
ScrFI CCNGG 1 cut(s) 76
SduI GDGCHC 1 cut(s) 175
SetI ASST 9 cut(s) 28, 45, 112, 175, 285, 292, 313, 363, 406
SfaNI GCATC 1 cut(s) 234
SfcI CTRYAG 1 cut(s) 15
Sse9I AATT 1 cut(s) 217
SsiI CCGC 2 cut(s) 5, 8
SspMI CTAG 2 cut(s) 287, 401
SstI GAGCTC 1 cut(s) 175
StyD4I CCNGG 1 cut(s) 74
TaiI ACGT 1 cut(s) 363
TasI AATT 1 cut(s) 217
TauI GCSGC 2 cut(s) 8, 11
Tru1I TTAA 1 cut(s) 231
Tru9I TTAA 1 cut(s) 231
TseI GCWGC 5 cut(s) 17, 20, 23, 110, 327
TspDTI ATGAA 1 cut(s) 82
XapI RAATTY 1 cut(s) 217
XcmI CCANNNNNNNNNTGG 1 cut(s) 364
XspI CTAG 2 cut(s) 287, 401
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.