Rmu_sc0000809.1_g000017

transcription factor

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000809.1
Physical Location & Seq
Reverse (-)
75115 .. 76506
1392 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000809.1_g000017.1.cds

Sequence Viewer

Length: 474 bp
atggtttctagggagcacaagagagcagcactttatgagaagctgcaacttcttcgttccattactaactctcatgctctaaaccaaacctcaatcatagtagacgcatcaaagtatattgaagagctaaaacagaaagtggaaaaactcaatcaagacattgcaaatgcaacttcaagtcatgaccaaaatcaattgccagtgcaggttacagtggaaaccctagaaaaggggtttctgataaatgtgttttcggaaaagagctgccccggtttgcttgtgtctgtactggaagccttcgaagagttgggtctaaatgtgcttgaagctagggtttcctgtgcagaaagtttcagactgcaggcagttggaggagaaaatgaagaagaaggcgaagggattgatgctcacgcagtcaaacaggcagtggctgtggctattaagagctggagtgaaagtaccgaacatgagtaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

157

Amino Acids

17.33

Weight (kDa)

4.99

Isoelectric Point (pI)

41.88

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 196
AccI GTMKAC 1 cut(s) 102
AfaI GTAC 2 cut(s) 288, 460
AfiI CCNNNNNNNGG 1 cut(s) 229
AgsI TTSAA 3 cut(s) 122, 177, 326
AluBI AGCT 5 cut(s) 43, 127, 264, 329, 447
AluI AGCT 5 cut(s) 43, 127, 264, 329, 447
Alw21I GWGCWC 1 cut(s) 18
AlwNI CAGNNNCTG 1 cut(s) 431
ApeKI GCWGC 3 cut(s) 26, 43, 264
AsuC2I CCSGG 1 cut(s) 270
AsuII TTCGAA 1 cut(s) 300
Bbv12I GWGCWC 1 cut(s) 18
BbvI GCAGC 3 cut(s) 30, 38, 251
BcgI CGANNNNNNTGC 2 cut(s) 35, 69
BcnI CCSGG 1 cut(s) 270
BfaI CTAG 3 cut(s) 9, 224, 330
BfmI CTRYAG 1 cut(s) 359
BfuAI ACCTGC 1 cut(s) 196
BisI GCNGC 3 cut(s) 27, 44, 265
BlsI GCNGC 3 cut(s) 28, 45, 266
Bme1390I CCNGG 1 cut(s) 270
BmrFI CCNGG 1 cut(s) 270
BmsI GCATC 2 cut(s) 116, 394
BpmI CTGGAG 1 cut(s) 469
Bpu14I TTCGAA 1 cut(s) 300
BpuMI CCSGG 1 cut(s) 270
BsaJI CCNNGG 1 cut(s) 268
BsaXI ACNNNNNCTCC 2 cut(s) 442, 472
Bsc4I CCNNNNNNNGG 1 cut(s) 229
Bse1I ACTGG 2 cut(s) 200, 294
Bse3DI GCAATG 1 cut(s) 159
BseDI CCNNGG 1 cut(s) 268
BseLI CCNNNNNNNGG 1 cut(s) 229
BseMI GCAATG 1 cut(s) 159
BseNI ACTGG 2 cut(s) 200, 294
BseRI GAGGAG 1 cut(s) 387
BseXI GCAGC 3 cut(s) 30, 38, 251
BsgI GTGCAG 2 cut(s) 224, 363
BsiHKAI GWGCWC 1 cut(s) 18
BsiSI CCGG 1 cut(s) 270
BslI CCNNNNNNNGG 1 cut(s) 229
Bsp119I TTCGAA 1 cut(s) 300
Bsp1286I GDGCHC 1 cut(s) 18
BspHI TCATGA 1 cut(s) 181
BspMAI CTGCAG 1 cut(s) 363
BspMI ACCTGC 1 cut(s) 196
BspQI GCTCTTC 1 cut(s) 117
BspT104I TTCGAA 1 cut(s) 300
BsrDI GCAATG 1 cut(s) 159
BsrI ACTGG 2 cut(s) 200, 294
BssECI CCNNGG 1 cut(s) 268
Bst4CI ACNGT 1 cut(s) 214
Bst6I CTCTTC 2 cut(s) 117, 297
BstBI TTCGAA 1 cut(s) 300
BstC8I GCNNGC 1 cut(s) 363
BstENI CCTNNNNNAGG 1 cut(s) 227
BstSCI CCNGG 1 cut(s) 268
BstSFI CTRYAG 1 cut(s) 359
BstV1I GCAGC 3 cut(s) 30, 38, 251
BtsI GCAGTG 1 cut(s) 432
BtsIMutI CAGTG 3 cut(s) 207, 219, 432
BveI ACCTGC 1 cut(s) 196
Cac8I GCNNGC 1 cut(s) 363
CaiI CAGNNNCTG 1 cut(s) 431
CciI TCATGA 1 cut(s) 181
CseI GACGC 1 cut(s) 113
Csp6I GTAC 2 cut(s) 287, 459
CviAII CATG 3 cut(s) 74, 182, 467
CviJI RGCY 8 cut(s) 43, 127, 264, 296, 329, 431, 437, 447
CviKI_1 RGCY 8 cut(s) 43, 127, 264, 296, 329, 431, 437, 447
CviQI GTAC 2 cut(s) 287, 459
Eam1104I CTCTTC 2 cut(s) 117, 297
EarI CTCTTC 2 cut(s) 117, 297
EcoNI CCTNNNNNAGG 1 cut(s) 227
FaeI CATG 3 cut(s) 77, 185, 470
FaiI YATR 6 cut(s) 36, 75, 98, 117, 183, 468
FatI CATG 3 cut(s) 73, 181, 466
FblI GTMKAC 1 cut(s) 102
Fnu4HI GCNGC 3 cut(s) 27, 44, 265
Fsp4HI GCNGC 3 cut(s) 27, 44, 265
FspBI CTAG 3 cut(s) 9, 224, 330
GluI GCNGC 3 cut(s) 27, 44, 265
GsuI CTGGAG 1 cut(s) 469
HapII CCGG 1 cut(s) 270
HgaI GACGC 1 cut(s) 113
Hin1II CATG 3 cut(s) 77, 185, 470
HpaII CCGG 1 cut(s) 270
Hpy166II GTNNAC 1 cut(s) 103
Hpy188I TCNGA 3 cut(s) 240, 256, 356
Hpy188III TCNNGA 2 cut(s) 155, 182
Hpy8I GTNNAC 1 cut(s) 103
HpyAV CCTTC 3 cut(s) 307, 383, 389
HpyCH4III ACNGT 1 cut(s) 214
HpyCH4V TGCA 6 cut(s) 46, 164, 170, 205, 344, 361
Hsp92II CATG 3 cut(s) 77, 185, 470
LguI GCTCTTC 1 cut(s) 117
LmnI GCTCC 1 cut(s) 13
LpnPI CCDG 8 cut(s) 191, 213, 275, 283, 347, 352, 407, 433
Lsp1109I GCAGC 3 cut(s) 30, 38, 251
LweI GCATC 2 cut(s) 116, 394
MaeI CTAG 3 cut(s) 9, 224, 330
MaeIII GTNAC 1 cut(s) 208
MboII GAAGA 5 cut(s) 44, 134, 314, 395, 398
MfeI CAATTG 1 cut(s) 194
MhlI GDGCHC 1 cut(s) 18
MluCI AATT 1 cut(s) 194
MmeI TCCRAC 1 cut(s) 349
MnlI CCTC 2 cut(s) 100, 365
MseI TTAA 1 cut(s) 441
MspI CCGG 1 cut(s) 270
MspR9I CCNGG 1 cut(s) 270
MunI CAATTG 1 cut(s) 194
NciI CCSGG 1 cut(s) 270
NlaIII CATG 3 cut(s) 77, 185, 470
NspV TTCGAA 1 cut(s) 300
PagI TCATGA 1 cut(s) 181
PciSI GCTCTTC 1 cut(s) 117
PkrI GCNGC 3 cut(s) 28, 45, 266
PstI CTGCAG 1 cut(s) 363
PstNI CAGNNNCTG 1 cut(s) 431
RsaI GTAC 2 cut(s) 288, 460
RsaNI GTAC 2 cut(s) 287, 459
SapI GCTCTTC 1 cut(s) 117
SaqAI TTAA 1 cut(s) 441
SatI GCNGC 3 cut(s) 27, 44, 265
ScrFI CCNGG 1 cut(s) 270
SduI GDGCHC 1 cut(s) 18
SetI ASST 7 cut(s) 45, 92, 129, 210, 266, 331, 449
SfaNI GCATC 2 cut(s) 116, 394
SfcI CTRYAG 1 cut(s) 359
SfuI TTCGAA 1 cut(s) 300
Sse9I AATT 1 cut(s) 194
SspMI CTAG 3 cut(s) 9, 224, 330
StyD4I CCNGG 1 cut(s) 268
TaaI ACNGT 1 cut(s) 214
TaqI TCGA 1 cut(s) 300
TasI AATT 1 cut(s) 194
TatI WGTACW 1 cut(s) 286
Tru1I TTAA 1 cut(s) 441
Tru9I TTAA 1 cut(s) 441
TscAI CASTG 3 cut(s) 207, 219, 432
TseI GCWGC 3 cut(s) 26, 43, 264
TspDTI ATGAA 1 cut(s) 396
TspRI CASTG 3 cut(s) 207, 219, 432
XagI CCTNNNNNAGG 1 cut(s) 227
XmiI GTMKAC 1 cut(s) 102
XspI CTAG 3 cut(s) 9, 224, 330
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.