Rw3G009210

Transcription factor

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr3
OG0001433
Physical Location & Seq
Forward (+)
8799086 .. 8800578
1493 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw3G009210.1

Sequence Viewer

Length: 375 bp
ATGAACAAAGCTTCAATTATAGTTGATGCATCCAAATACATCCAGGAGTTGAAGCAGAAAGTGGACACGCTCAACCAAGACGTTGGAACTTCGCAAAATTCATCGTCACCTGCGCAGGTTACTGTGGAAACCCTAGAAAGGGGTTTTCTTATTAGTGTCTTGTCAGAAAAGAACTGCCCAGGTTTGCTCGTTTCCATTCTAGAAGCCTTTGAAGACCTGGGCCTTGATGTGCTCGATGCTAGGGTTTCTTGTGCAGACAGTTTCCAACTGGAAGCGGTTGGAGGAGAAAACCAAGGAGAGGCTGATAGCATAGATGCACAGGTGGTGAAACAAGCGGTGTTGCAAGCTATTCAGAACTGGAGCCAGAGCAACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

124

Amino Acids

13.31

Weight (kDa)

4.17

Isoelectric Point (pI)

33.74

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
bHLH-TF_ACT-like_plant PF22754 39 - 118 2.3e-26 Plant bHLH transcription factor, ACT-like domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 118
Acc16I TGCGCA 1 cut(s) 114
Acc36I ACCTGC 2 cut(s) 106, 118
AciI CCGC 2 cut(s) 275, 335
AcsI RAATTY 1 cut(s) 97
AfiI CCNNNNNNNGG 3 cut(s) 138, 139, 298
AgsI TTSAA 3 cut(s) 15, 52, 212
AjnI CCWGG 3 cut(s) 42, 178, 216
AluBI AGCT 2 cut(s) 11, 347
AluI AGCT 2 cut(s) 11, 347
Alw21I GWGCWC 1 cut(s) 234
AoxI GGCC 1 cut(s) 220
ApoI RAATTY 1 cut(s) 97
AspLEI GCGC 1 cut(s) 115
AspS9I GGNCC 1 cut(s) 220
AsuHPI GGTGA 2 cut(s) 99, 337
BbsI GAAGAC 1 cut(s) 219
Bbv12I GWGCWC 1 cut(s) 234
BciT130I CCWGG 3 cut(s) 44, 180, 218
BfaI CTAG 4 cut(s) 134, 200, 240, 373
BfuAI ACCTGC 2 cut(s) 106, 118
Bme1390I CCNGG 3 cut(s) 44, 180, 218
BmgT120I GGNCC 1 cut(s) 220
BmiI GGNNCC 1 cut(s) 362
BmrFI CCNGG 3 cut(s) 44, 180, 218
BmsI GCATC 4 cut(s) 16, 38, 226, 304
BpiI GAAGAC 1 cut(s) 219
BsaJI CCNNGG 3 cut(s) 178, 217, 292
Bsc4I CCNNNNNNNGG 3 cut(s) 138, 139, 298
Bse1I ACTGG 2 cut(s) 273, 362
BseBI CCWGG 3 cut(s) 44, 180, 218
BseDI CCNNGG 3 cut(s) 178, 217, 292
BseGI GGATG 2 cut(s) 29, 39
BseLI CCNNNNNNNGG 3 cut(s) 138, 139, 298
BseNI ACTGG 2 cut(s) 273, 362
BseRI GAGGAG 1 cut(s) 297
BsgI GTGCAG 1 cut(s) 273
BshFI GGCC 1 cut(s) 222
BsiHKAI GWGCWC 1 cut(s) 234
BslI CCNNNNNNNGG 3 cut(s) 138, 139, 298
BsnI GGCC 1 cut(s) 222
Bsp1286I GDGCHC 1 cut(s) 234
BspACI CCGC 2 cut(s) 275, 335
BspANI GGCC 1 cut(s) 222
BspLI GGNNCC 1 cut(s) 362
BspMI ACCTGC 2 cut(s) 106, 118
BsrI ACTGG 2 cut(s) 273, 362
BssECI CCNNGG 3 cut(s) 178, 217, 292
BssT1I CCWWGG 1 cut(s) 292
Bst2UI CCWGG 3 cut(s) 44, 180, 218
Bst4CI ACNGT 2 cut(s) 124, 260
BstC8I GCNNGC 1 cut(s) 345
BstF5I GGATG 2 cut(s) 29, 39
BstHHI GCGC 1 cut(s) 115
BstNI CCWGG 3 cut(s) 44, 180, 218
BstSCI CCNGG 3 cut(s) 42, 178, 216
BstV2I GAAGAC 1 cut(s) 219
BstXI CCANNNNNNTGG 1 cut(s) 83
BsuRI GGCC 1 cut(s) 222
BtsCI GGATG 2 cut(s) 29, 39
BveI ACCTGC 2 cut(s) 106, 118
Cac8I GCNNGC 1 cut(s) 345
CfoI GCGC 1 cut(s) 115
Cfr13I GGNCC 1 cut(s) 220
CviJI RGCY 6 cut(s) 11, 206, 222, 302, 347, 363
CviKI_1 RGCY 6 cut(s) 11, 206, 222, 302, 347, 363
Eco130I CCWWGG 1 cut(s) 292
EcoRII CCWGG 3 cut(s) 42, 178, 216
EcoT14I CCWWGG 1 cut(s) 292
EcoT22I ATGCAT 1 cut(s) 31
ErhI CCWWGG 1 cut(s) 292
FaiI YATR 2 cut(s) 20, 311
FokI GGATG 2 cut(s) 16, 26
FspBI CTAG 4 cut(s) 134, 200, 240, 373
FspI TGCGCA 1 cut(s) 114
GlaI GCGC 1 cut(s) 114
HaeIII GGCC 1 cut(s) 222
HhaI GCGC 1 cut(s) 115
Hin6I GCGC 1 cut(s) 113
HinP1I GCGC 1 cut(s) 113
HindIII AAGCTT 1 cut(s) 9
HphI GGTGA 2 cut(s) 99, 337
Hpy166II GTNNAC 1 cut(s) 64
Hpy188I TCNGA 2 cut(s) 166, 354
Hpy188III TCNNGA 1 cut(s) 200
Hpy8I GTNNAC 1 cut(s) 64
HpyCH4III ACNGT 2 cut(s) 124, 260
HpyCH4IV ACGT 1 cut(s) 81
HpyCH4V TGCA 4 cut(s) 29, 254, 317, 343
HpySE526I ACGT 1 cut(s) 81
HspAI GCGC 1 cut(s) 113
LmnI GCTCC 1 cut(s) 360
LweI GCATC 4 cut(s) 16, 38, 226, 304
MaeI CTAG 4 cut(s) 134, 200, 240, 373
MaeII ACGT 1 cut(s) 81
MaeIII GTNAC 2 cut(s) 105, 118
MboII GAAGA 1 cut(s) 224
MhlI GDGCHC 1 cut(s) 234
MluCI AATT 2 cut(s) 15, 97
MmeI TCCRAC 3 cut(s) 64, 259, 289
MnlI CCTC 2 cut(s) 275, 292
Mph1103I ATGCAT 1 cut(s) 31
MspR9I CCNGG 3 cut(s) 44, 180, 218
MvaI CCWGG 3 cut(s) 44, 180, 218
NlaIV GGNNCC 1 cut(s) 362
NmuCI GTSAC 1 cut(s) 105
NsbI TGCGCA 1 cut(s) 114
NsiI ATGCAT 1 cut(s) 31
PaqCI CACCTGC 1 cut(s) 118
PfoI TCCNGGA 1 cut(s) 42
Psp6I CCWGG 3 cut(s) 42, 178, 216
PspGI CCWGG 3 cut(s) 42, 178, 216
PspN4I GGNNCC 1 cut(s) 362
PspPI GGNCC 1 cut(s) 220
Sau96I GGNCC 1 cut(s) 220
ScrFI CCNGG 3 cut(s) 44, 180, 218
SduI GDGCHC 1 cut(s) 234
SetI ASST 8 cut(s) 13, 84, 112, 120, 184, 219, 324, 349
SfaNI GCATC 4 cut(s) 16, 38, 226, 304
Sse9I AATT 2 cut(s) 15, 97
SsiI CCGC 2 cut(s) 275, 335
SspMI CTAG 4 cut(s) 134, 200, 240, 373
StyD4I CCNGG 3 cut(s) 42, 178, 216
StyI CCWWGG 1 cut(s) 292
TaaI ACNGT 2 cut(s) 124, 260
TaiI ACGT 1 cut(s) 84
TaqI TCGA 1 cut(s) 234
TasI AATT 2 cut(s) 15, 97
TseFI GTSAC 1 cut(s) 105
Tsp45I GTSAC 1 cut(s) 105
TspDTI ATGAA 2 cut(s) 17, 90
XapI RAATTY 1 cut(s) 97
XbaI TCTAGA 1 cut(s) 199
XspI CTAG 4 cut(s) 134, 200, 240, 373
Zsp2I ATGCAT 1 cut(s) 31
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.