Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0000829.1

Orthogroup ID

OG0002751

Physical Location & Seq

Genomic Coordinates Forward (+)

92916 .. 94865

Gene Structure 1950 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0000829.1_g000017.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1293 bp

atgcaagcaagtagtggcaatagcgttccaatagcagctattttcaagacagcttctggatttataagtgctggtgagattattgcggaatcaaattgttggtccatgctcaagggtggtctaactgtcaaggcttcaggcgatgccgagctctatttcgagaatcgtaaaaccaaggtgcgaatccaagcagttgatgcacaaggcaatcctctaccaaatgctacaatctccatccaacaaaaggctccaagtttcccttttggttgttgtatgaccaatctcatcctcaacaaccctgcccaccaaaagtggtttacgtcaaggttcagagtaacaacatttgctaacgaaatgaaatggtatagcacagagaatgtccagggacgtgaggactactcagtgcctgatgccatgcttcagtttgcacaacaaaacaacattgcagttagaggccataatgtgttctgggatgattcccagtaccaactcggttgggtcaaatcgctcaatgagcaacaacttgaaagtgcaactaacaagaggctaaattctgttatgcagagatacaagggcaaggtcattgcttgggatgttgtcaacgaaaatttacattggaatttctttgaaagtaggatgggtgcaaatgcttcagcaattttttataactgggctattaaagctgatggagcaacccccttgttcttgaatgactttaataccattgaggatagcagagatgaagcagcctctccagctaagtaccttcaaaagctcagagatatacaaagctttccgggtaatgagggtggacgatatgggattgggcttgagtctcatttcaatattactcctaacattccttacatacgagcttctcttgatactcttggtgctgcaaatgtgcccatttggatcacagaattggacgtagcagatcatcttgatcagccaagtatattggagcagcttcttagagagttgcattctcaccctcagattcaaggaatcattatgtgggctggacggggaccccaaggatgttacagaatgtgtttgacagatgaaaactttaacaacttgccaaccggtgacgttgtggacaagttactgaaggaatggggttattggagctcagcttctttcacagcagactccaatggttattttgaggcctcccttccccatggagattatgacttgaagatcagccattcttcagccatagattcctccttggttcacaaattgaacgtggcatcaacaactaggtctctgcaactttctttttaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0005488 GO:0008270 GO:0043167 GO:0043169 GO:0046872 GO:0046914

KEGG Pathways

Metabolic & Signaling

ko04013 ko04115 ko04120 ko04310 map04013 map04115 map04120 map04310

Pfam Domains

Protein Families

PDZ

Protein Analysis

430

Amino Acids

48.04

Weight (kDa)

5.72

Isoelectric Point (pI)

32.48

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002751)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT4G33830 AT4G33840 AT4G33860
fragaria_vesca	FvH4_2g03792 FvH4_2g03793 FvH4_2g03793 FvH4_2g03840 FvH4_3g40060
malus_domestica	MD05G1100700.v1.1 MD10G1105900.v1.1 MD10G1106500.v1.1
prunus_persica	Prupe.8G145100_v2.0.a1 Prupe.8G145200_v2.0.a1 Prupe.8G145300_v2.0.a1
rosa_chinensis	RchiOBHm_Chr5g0072231 RchiOBHm_Chr6g0252841 RchiOBHm_Chr6g0252851
rosa_laevigata	RLG00000015059 RLG00000015061
rosa_multiflora	Rmu_co8129022.1_g000001 Rmu_sc0000714.1_g000002 Rmu_sc0000829.1_g000017 Rmu_sc0000829.1_g000029 Rmu_sc0028322.1_g000001
rosa_roxburghii	Rroxscaffold_7G00212390
rosa_rugosa	Rorug05G0417000 Rorug05G0539100
rosa_samantha	Rh5DG505200 Rh6AG055100 Rh6BG049200 Rh6CG047900 Rh6CG048000 Rh6CG048100 Rh6DG043400 Rh6DG043600 Rh6DG043700
rosa_wichuraiana	Rw5G043950 Rw6G004970 Rw6G004990

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	2 cut(s)	65, 666
AciI	CCGC	1 cut(s)	86
AclWI	GGATC	1 cut(s)	923
AcsI	RAATTY	3 cut(s)	550, 607, 619
AcuI	CTGAAG	5 cut(s)	120, 404, 636, 1133, 1203
AfaI	GTAC	2 cut(s)	485, 764
AfiI	CCNNNNNNNGG	1 cut(s)	244
AgeI	ACCGGT	1 cut(s)	1088
AgsI	TTSAA	9 cut(s)	46, 527, 629, 709, 770, 844, 1004, 1204, 1252
AjiI	CACGTC	1 cut(s)	389
AjnI	CCWGG	1 cut(s)	381
Alw21I	GWGCWC	2 cut(s)	153, 1136
Alw26I	GTCTC	2 cut(s)	840, 1278
AlwI	GGATC	1 cut(s)	923
AlwNI	CAGNNNCTG	2 cut(s)	56, 407
AoxI	GGCC	2 cut(s)	454, 1173
ApeKI	GCWGC	4 cut(s)	35, 746, 896, 967
ApoI	RAATTY	3 cut(s)	550, 607, 619
ArsI	GACNNNNNNTTYG	2 cut(s)	86, 118
AsiGI	ACCGGT	1 cut(s)	1088
AspS9I	GGNCC	2 cut(s)	102, 1031
AsuC2I	CCSGG	1 cut(s)	798
AsuHPI	GGTGA	3 cut(s)	86, 983, 1103
AvaII	GGWCC	2 cut(s)	102, 1031
BaeGI	GKGCMC	1 cut(s)	909
BanII	GRGCYC	2 cut(s)	153, 1136
Bbv12I	GWGCWC	2 cut(s)	153, 1136
BbvI	GCAGC	4 cut(s)	47, 758, 883, 979
BccI	CCATC	3 cut(s)	242, 631, 680
BciT130I	CCWGG	1 cut(s)	383
BclI	TGATCA	1 cut(s)	946
BcnI	CCSGG	1 cut(s)	798
BcoDI	GTCTC	2 cut(s)	840, 1278
BfaI	CTAG	1 cut(s)	1269
BisI	GCNGC	4 cut(s)	36, 747, 897, 968
BlpI	GCTNAGC	1 cut(s)	1135
BlsI	GCNGC	4 cut(s)	37, 748, 898, 969
Bme1390I	CCNGG	2 cut(s)	383, 798
Bme18I	GGWCC	2 cut(s)	102, 1031
BmgBI	CACGTC	1 cut(s)	389
BmgT120I	GGNCC	2 cut(s)	102, 1031
BmiI	GGNNCC	3 cut(s)	249, 1032, 1033
BmrFI	CCNGG	2 cut(s)	383, 798
BmrI	ACTGGG	2 cut(s)	475, 679
BmsI	GCATC	4 cut(s)	133, 187, 400, 1268
BmuI	ACTGGG	2 cut(s)	475, 679
BplI	GAGNNNNNCTC	2 cut(s)	383, 415
BpmI	CTGGAG	1 cut(s)	738
Bpu1102I	GCTNAGC	1 cut(s)	1135
BpuEI	CTTGAG	2 cut(s)	95, 851
BpuMI	CCSGG	1 cut(s)	798
BsaI	GGTCTC	1 cut(s)	1278
BsaJI	CCNNGG	5 cut(s)	174, 382, 1036, 1186, 1236
BsaWI	WCCGGW	1 cut(s)	1088
Bsc4I	CCNNNNNNNGG	1 cut(s)	244
Bse118I	RCCGGY	1 cut(s)	1088
Bse1I	ACTGG	2 cut(s)	481, 674
Bse3DI	GCAATG	2 cut(s)	441, 582
BseBI	CCWGG	1 cut(s)	383
BseDI	CCNNGG	5 cut(s)	174, 382, 1036, 1186, 1236
BseGI	GGATG	6 cut(s)	234, 285, 478, 598, 642, 1046
BseLI	CCNNNNNNNGG	1 cut(s)	244
BseMI	GCAATG	2 cut(s)	441, 582
BseMII	CTCAG	4 cut(s)	414, 790, 1010, 1149
BseNI	ACTGG	2 cut(s)	481, 674
BseSI	GKGCMC	1 cut(s)	909
BseXI	GCAGC	4 cut(s)	47, 758, 883, 979
BshFI	GGCC	2 cut(s)	456, 1175
BshTI	ACCGGT	1 cut(s)	1088
BsiHKAI	GWGCWC	2 cut(s)	153, 1136
BsiSI	CCGG	2 cut(s)	797, 1089
BslFI	GGGAC	2 cut(s)	399, 1044
BslI	CCNNNNNNNGG	1 cut(s)	244
BsmAI	GTCTC	2 cut(s)	840, 1278
BsmFI	GGGAC	2 cut(s)	399, 1044
BsmI	GAATGC	1 cut(s)	985
BsnI	GGCC	2 cut(s)	456, 1175
Bso31I	GGTCTC	1 cut(s)	1278
Bsp1286I	GDGCHC	3 cut(s)	153, 909, 1136
Bsp143I	GATC	4 cut(s)	915, 937, 946, 1206
Bsp1720I	GCTNAGC	1 cut(s)	1135
Bsp19I	CCATGG	1 cut(s)	1186
BspACI	CCGC	1 cut(s)	86
BspANI	GGCC	2 cut(s)	456, 1175
BspCNI	CTCAG	4 cut(s)	413, 789, 1009, 1148
BspLI	GGNNCC	3 cut(s)	249, 1032, 1033
BspPI	GGATC	1 cut(s)	923
BspTNI	GGTCTC	1 cut(s)	1278
BsrDI	GCAATG	2 cut(s)	441, 582
BsrFI	RCCGGY	1 cut(s)	1088
BsrI	ACTGG	2 cut(s)	481, 674
BssAI	RCCGGY	1 cut(s)	1088
BssECI	CCNNGG	5 cut(s)	174, 382, 1036, 1186, 1236
BssMI	GATC	4 cut(s)	915, 937, 946, 1206
BssT1I	CCWWGG	4 cut(s)	174, 1036, 1186, 1236
Bst2UI	CCWGG	1 cut(s)	383
Bst4CI	ACNGT	1 cut(s)	127
BstAPI	GCANNNNNTGC	1 cut(s)	197
BstC8I	GCNNGC	1 cut(s)	6
BstDEI	CTNAG	6 cut(s)	400, 759, 776, 974, 996, 1135
BstDSI	CCRYGG	1 cut(s)	1186
BstF5I	GGATG	6 cut(s)	234, 285, 478, 598, 642, 1046
BstKTI	GATC	4 cut(s)	918, 940, 949, 1209
BstMAI	GTCTC	2 cut(s)	840, 1278
BstMBI	GATC	4 cut(s)	915, 937, 946, 1206
BstMWI	GCNNNNNNNGC	5 cut(s)	197, 514, 680, 689, 755
BstNI	CCWGG	1 cut(s)	383
BstSCI	CCNGG	2 cut(s)	381, 796
BstSLI	GKGCMC	1 cut(s)	909
BstV1I	GCAGC	4 cut(s)	47, 758, 883, 979
BsuRI	GGCC	2 cut(s)	456, 1175
BtgI	CCRYGG	1 cut(s)	1186
BtgZI	GCGATG	1 cut(s)	156
BtrI	CACGTC	1 cut(s)	389
BtsCI	GGATG	6 cut(s)	234, 285, 478, 598, 642, 1046
BtsIMutI	CAGTG	1 cut(s)	408
Cac8I	GCNNGC	1 cut(s)	6
CaiI	CAGNNNCTG	2 cut(s)	56, 407
Cfr10I	RCCGGY	1 cut(s)	1088
Cfr13I	GGNCC	2 cut(s)	102, 1031
Csp6I	GTAC	2 cut(s)	484, 763
CspAI	ACCGGT	1 cut(s)	1088
CviAII	CATG	3 cut(s)	106, 415, 1187
CviQI	GTAC	2 cut(s)	484, 763
DdeI	CTNAG	6 cut(s)	400, 759, 776, 974, 996, 1135
DpnI	GATC	4 cut(s)	917, 939, 948, 1208
DpnII	GATC	4 cut(s)	915, 937, 946, 1206
Ecl136II	GAGCTC	2 cut(s)	151, 1134
Eco130I	CCWWGG	4 cut(s)	174, 1036, 1186, 1236
Eco147I	AGGCCT	1 cut(s)	1175
Eco24I	GRGCYC	2 cut(s)	153, 1136
Eco31I	GGTCTC	1 cut(s)	1278
Eco47I	GGWCC	2 cut(s)	102, 1031
Eco53kI	GAGCTC	2 cut(s)	151, 1134
Eco57I	CTGAAG	5 cut(s)	120, 404, 636, 1133, 1203
EcoICRI	GAGCTC	2 cut(s)	151, 1134
EcoO109I	RGGNCCY	1 cut(s)	1031
EcoRII	CCWGG	1 cut(s)	381
EcoT14I	CCWWGG	4 cut(s)	174, 1036, 1186, 1236
EcoT38I	GRGCYC	2 cut(s)	153, 1136
ErhI	CCWWGG	4 cut(s)	174, 1036, 1186, 1236
FaeI	CATG	3 cut(s)	109, 418, 1190
FalI	AAGNNNNNCTT	2 cut(s)	244, 276
FaqI	GGGAC	2 cut(s)	399, 1044
FatI	CATG	3 cut(s)	105, 414, 1186
FbaI	TGATCA	1 cut(s)	946
Fnu4HI	GCNGC	4 cut(s)	36, 747, 897, 968
FokI	GGATG	6 cut(s)	221, 272, 485, 605, 649, 1053
FriOI	GRGCYC	2 cut(s)	153, 1136
Fsp4HI	GCNGC	4 cut(s)	36, 747, 897, 968
FspBI	CTAG	1 cut(s)	1269
GluI	GCNGC	4 cut(s)	36, 747, 897, 968
GsuI	CTGGAG	1 cut(s)	738
HaeIII	GGCC	2 cut(s)	456, 1175
HapII	CCGG	2 cut(s)	797, 1089
Hin1II	CATG	3 cut(s)	109, 418, 1190
HincII	GTYRAC	1 cut(s)	601
HindII	GTYRAC	1 cut(s)	601
HindIII	AAGCTT	1 cut(s)	790
HinfI	GANTC	9 cut(s)	89, 163, 183, 476, 833, 1000, 1008, 1154, 1229
HpaII	CCGG	2 cut(s)	797, 1089
HphI	GGTGA	3 cut(s)	86, 983, 1103
Hpy166II	GTNNAC	5 cut(s)	318, 601, 812, 1102, 1243
Hpy188I	TCNGA	3 cut(s)	332, 779, 999
Hpy188III	TCNNGA	6 cut(s)	46, 57, 160, 706, 881, 944
Hpy8I	GTNNAC	5 cut(s)	318, 601, 812, 1102, 1243
HpyAV	CCTTC	3 cut(s)	776, 1108, 1190
HpyCH4III	ACNGT	1 cut(s)	127
HpyCH4IV	ACGT	5 cut(s)	320, 388, 930, 1095, 1254
HpyF10VI	GCNNNNNNNGC	5 cut(s)	197, 514, 680, 689, 755
HpyF3I	CTNAG	6 cut(s)	400, 759, 776, 974, 996, 1135
HpySE526I	ACGT	5 cut(s)	320, 388, 930, 1095, 1254
Hsp92II	CATG	3 cut(s)	109, 418, 1190
KflI	GGGWCCC	1 cut(s)	1031
Ksp22I	TGATCA	1 cut(s)	946
Kzo9I	GATC	4 cut(s)	915, 937, 946, 1206
LmnI	GCTCC	4 cut(s)	253, 689, 964, 1131
Lsp1109I	GCAGC	4 cut(s)	47, 758, 883, 979
LweI	GCATC	4 cut(s)	133, 187, 400, 1268
MaeI	CTAG	1 cut(s)	1269
MaeII	ACGT	5 cut(s)	320, 388, 930, 1095, 1254
MaeIII	GTNAC	4 cut(s)	334, 1043, 1091, 1107
MalI	GATC	4 cut(s)	917, 939, 948, 1208
MboI	GATC	4 cut(s)	915, 937, 946, 1206
MboII	GAAGA	2 cut(s)	1209, 1216
MhlI	GDGCHC	3 cut(s)	153, 909, 1136
MluCI	AATT	7 cut(s)	94, 550, 607, 619, 657, 923, 1247
MlyI	GAGTC	2 cut(s)	842, 1148
MmeI	TCCRAC	1 cut(s)	262
MseI	TTAA	4 cut(s)	678, 717, 1074, 1291
MspI	CCGG	2 cut(s)	797, 1089
MspR9I	CCNGG	2 cut(s)	383, 798
Mva1269I	GAATGC	1 cut(s)	985
MvaI	CCWGG	1 cut(s)	383
MwoI	GCNNNNNNNGC	5 cut(s)	197, 514, 680, 689, 755
NciI	CCSGG	1 cut(s)	798
NcoI	CCATGG	1 cut(s)	1186
NdeII	GATC	4 cut(s)	915, 937, 946, 1206
NlaIII	CATG	3 cut(s)	109, 418, 1190
NlaIV	GGNNCC	3 cut(s)	249, 1032, 1033
NmeAIII	GCCGAG	1 cut(s)	172
NmuCI	GTSAC	1 cut(s)	1091
PceI	AGGCCT	1 cut(s)	1175
PctI	GAATGC	1 cut(s)	985
PfeI	GAWTC	7 cut(s)	89, 163, 183, 476, 1000, 1008, 1229
PinAI	ACCGGT	1 cut(s)	1088
PkrI	GCNGC	4 cut(s)	37, 748, 898, 969
PleI	GAGTC	2 cut(s)	841, 1148
PpsI	GAGTC	2 cut(s)	841, 1148
PpuMI	RGGWCCY	1 cut(s)	1031
PsiI	TTATAA	2 cut(s)	65, 666
Psp124BI	GAGCTC	2 cut(s)	153, 1136
Psp5II	RGGWCCY	1 cut(s)	1031
Psp6I	CCWGG	1 cut(s)	381
PspGI	CCWGG	1 cut(s)	381
PspN4I	GGNNCC	3 cut(s)	249, 1032, 1033
PspPI	GGNCC	2 cut(s)	102, 1031
PspPPI	RGGWCCY	1 cut(s)	1031
PstNI	CAGNNNCTG	2 cut(s)	56, 407
RsaI	GTAC	2 cut(s)	485, 764
RsaNI	GTAC	2 cut(s)	484, 763
SacI	GAGCTC	2 cut(s)	153, 1136
SaqAI	TTAA	4 cut(s)	678, 717, 1074, 1291
SatI	GCNGC	4 cut(s)	36, 747, 897, 968
Sau3AI	GATC	4 cut(s)	915, 937, 946, 1206
Sau96I	GGNCC	2 cut(s)	102, 1031
SchI	GAGTC	2 cut(s)	842, 1148
ScrFI	CCNGG	2 cut(s)	383, 798
SduI	GDGCHC	3 cut(s)	153, 909, 1136
SfaNI	GCATC	4 cut(s)	133, 187, 400, 1268
SinI	GGWCC	2 cut(s)	102, 1031
SmlI	CTYRAG	2 cut(s)	110, 830
SmoI	CTYRAG	2 cut(s)	110, 830
Sse9I	AATT	7 cut(s)	94, 550, 607, 619, 657, 923, 1247
SseBI	AGGCCT	1 cut(s)	1175
SsiI	CCGC	1 cut(s)	86
SspI	AATATT	1 cut(s)	847
SspMI	CTAG	1 cut(s)	1269
SstI	GAGCTC	2 cut(s)	153, 1136
StuI	AGGCCT	1 cut(s)	1175
StyD4I	CCNGG	2 cut(s)	381, 796
StyI	CCWWGG	4 cut(s)	174, 1036, 1186, 1236
TaaI	ACNGT	1 cut(s)	127
TaiI	ACGT	5 cut(s)	323, 391, 933, 1098, 1257
TaqI	TCGA	1 cut(s)	159
TasI	AATT	7 cut(s)	94, 550, 607, 619, 657, 923, 1247
TfiI	GAWTC	7 cut(s)	89, 163, 183, 476, 1000, 1008, 1229
Tru1I	TTAA	4 cut(s)	678, 717, 1074, 1291
Tru9I	TTAA	4 cut(s)	678, 717, 1074, 1291
TscAI	CASTG	1 cut(s)	408
TseFI	GTSAC	1 cut(s)	1091
TseI	GCWGC	4 cut(s)	35, 746, 896, 967
Tsp45I	GTSAC	1 cut(s)	1091
TspDTI	ATGAA	3 cut(s)	371, 756, 1080
TspRI	CASTG	1 cut(s)	408
VpaK11BI	GGWCC	2 cut(s)	102, 1031
XapI	RAATTY	3 cut(s)	550, 607, 619
XspI	CTAG	1 cut(s)	1269

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.