Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0001211.1

Orthogroup ID

OG0004877

Physical Location & Seq

Genomic Coordinates Forward (+)

520660 .. 521029

Gene Structure 370 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0001211.1_g000131.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 279 bp

atgtatgatcaagcgggttacgctctttggttttgcgattacaaatacaacgatgaaaatacagtctcattcgtgactttaaacaaggtgggccgttttctgcaacggatggatttgccttgtaaatatgcgtttgggaagatgttggtgattgggtctgatcctcctttcaaggttgatatcactgatgaggatcaaaagaagcgtgtgaaccagatgattgaagatcacgagccttttgagggggaggcttttttggatgccaaatgcttcgagtga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003676 GO:0003723 GO:0003746 GO:0003824 GO:0004364 GO:0005488 GO:0005507 GO:0005575 GO:0005618 GO:0005622 GO:0005623 GO:0005634 GO:0005737 GO:0005773 GO:0005829 GO:0005886 GO:0005911 GO:0006412 GO:0006414 GO:0006518 GO:0006575 GO:0006749 GO:0006790 GO:0006807 GO:0008135 GO:0008150 GO:0008152 GO:0009058 GO:0009059 GO:0009506 GO:0009987 GO:0010035 GO:0010038 GO:0010043 GO:0010467 GO:0016020 GO:0016740 GO:0016765 GO:0019538 GO:0030054 GO:0030312 GO:0034641 GO:0034645 GO:0042221 GO:0043043 GO:0043167 GO:0043169 GO:0043170 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0043603 GO:0043604 GO:0044237 GO:0044238 GO:0044249 GO:0044260 GO:0044267 GO:0044271 GO:0044424 GO:0044444 GO:0044464 GO:0046686 GO:0046872 GO:0046914 GO:0050896 GO:0051186 GO:0055044 GO:0071704 GO:0071944 GO:0097159 GO:1901363 GO:1901564 GO:1901566 GO:1901576

KEGG Pathways

Metabolic & Signaling

ko05134 map05134

Pfam Domains

Protein Families

EF1G GST_C GST_N

Protein Analysis

92

Amino Acids

10.81

Weight (kDa)

4.68

Isoelectric Point (pI)

45.3

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0004877)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr1g0340781 RchiOBHm_Chr7g0229491 RchiOBHm_Chr7g0229531 RchiOBHm_Chr7g0229701 RchiOBHm_Chr7g0229951 RchiOBHm_Chr7g0230081 RchiOBHm_Chr7g0230221 RchiOBHm_Chr7g0231551
rosa_multiflora	Rmu_sc0000693.1_g000061 Rmu_sc0000693.1_g000078 Rmu_sc0001192.1_g000020 Rmu_sc0001211.1_g000131 Rmu_sc0002545.1_g000005 Rmu_sc0003327.1_g000003 Rmu_sc0004110.1_g000010 Rmu_sc0007557.1_g000001 Rmu_sc0010898.1_g000003 Rmu_sc0018024.1_g000001 Rmu_sc0027028.1_g000001
rosa_roxburghii	Rroxscaffold_4G00311400
rosa_rugosa	Rorug07G0227000
rosa_samantha	Rh1AG176700 Rh1CG164200 Rh7AG409200 Rh7AG409900 Rh7AG421800 Rh7CG427200 Rh7CG427900 Rh7CG442000
rosa_wichuraiana	Rw0G001870 Rw0G022610

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	1 cut(s)	14
AclWI	GGATC	2 cut(s)	155, 201
AfiI	CCNNNNNNNGG	1 cut(s)	242
AgsI	TTSAA	2 cut(s)	172, 224
Alw26I	GTCTC	1 cut(s)	70
AlwI	GGATC	2 cut(s)	155, 201
AoxI	GGCC	1 cut(s)	91
AspS9I	GGNCC	1 cut(s)	91
AsuHPI	GGTGA	1 cut(s)	160
BauI	CACGAG	1 cut(s)	230
BccI	CCATC	1 cut(s)	103
BceAI	ACGGC	1 cut(s)	78
BclI	TGATCA	1 cut(s)	7
BcoDI	GTCTC	1 cut(s)	70
BmgT120I	GGNCC	1 cut(s)	91
BmsI	GCATC	1 cut(s)	250
BsaBI	GATNNNNATC	1 cut(s)	192
Bsc4I	CCNNNNNNNGG	1 cut(s)	242
Bse8I	GATNNNNATC	1 cut(s)	192
BseGI	GGATG	2 cut(s)	114, 265
BseJI	GATNNNNATC	1 cut(s)	192
BseLI	CCNNNNNNNGG	1 cut(s)	242
BshFI	GGCC	1 cut(s)	93
BslI	CCNNNNNNNGG	1 cut(s)	242
BsmAI	GTCTC	1 cut(s)	70
BsnI	GGCC	1 cut(s)	93
Bsp143I	GATC	4 cut(s)	7, 160, 193, 226
BspACI	CCGC	1 cut(s)	14
BspANI	GGCC	1 cut(s)	93
BspPI	GGATC	2 cut(s)	155, 201
BssMI	GATC	4 cut(s)	7, 160, 193, 226
BssSI	CACGAG	1 cut(s)	230
Bst2BI	CACGAG	1 cut(s)	230
Bst4CI	ACNGT	1 cut(s)	64
BstF5I	GGATG	2 cut(s)	114, 265
BstKTI	GATC	4 cut(s)	10, 163, 196, 229
BstMAI	GTCTC	1 cut(s)	70
BstMBI	GATC	4 cut(s)	7, 160, 193, 226
BstMWI	GCNNNNNNNGC	1 cut(s)	20
BsuRI	GGCC	1 cut(s)	93
BtsCI	GGATG	2 cut(s)	114, 265
BtsIMutI	CAGTG	1 cut(s)	183
Cfr13I	GGNCC	1 cut(s)	91
CviJI	RGCY	3 cut(s)	93, 235, 251
CviKI_1	RGCY	3 cut(s)	93, 235, 251
DpnI	GATC	4 cut(s)	9, 162, 195, 228
DpnII	GATC	4 cut(s)	7, 160, 193, 226
DraI	TTTAAA	1 cut(s)	81
Eco32I	GATATC	1 cut(s)	181
EcoRV	GATATC	1 cut(s)	181
FaiI	YATR	2 cut(s)	6, 129
FauI	CCCGC	1 cut(s)	7
FbaI	TGATCA	1 cut(s)	7
FokI	GGATG	2 cut(s)	121, 272
HaeIII	GGCC	1 cut(s)	93
HphI	GGTGA	1 cut(s)	160
Hpy166II	GTNNAC	1 cut(s)	211
Hpy188I	TCNGA	1 cut(s)	160
Hpy188III	TCNNGA	2 cut(s)	73, 230
Hpy8I	GTNNAC	1 cut(s)	211
HpyCH4III	ACNGT	1 cut(s)	64
HpyCH4V	TGCA	1 cut(s)	103
HpyF10VI	GCNNNNNNNGC	1 cut(s)	20
Ksp22I	TGATCA	1 cut(s)	7
Kzo9I	GATC	4 cut(s)	7, 160, 193, 226
LpnPI	CCDG	1 cut(s)	227
LweI	GCATC	1 cut(s)	250
MaeIII	GTNAC	2 cut(s)	17, 73
MalI	GATC	4 cut(s)	9, 162, 195, 228
MboI	GATC	4 cut(s)	7, 160, 193, 226
MboII	GAAGA	2 cut(s)	151, 236
MnlI	CCTC	4 cut(s)	174, 184, 235, 241
MseI	TTAA	1 cut(s)	80
MwoI	GCNNNNNNNGC	1 cut(s)	20
NdeII	GATC	4 cut(s)	7, 160, 193, 226
NmuCI	GTSAC	1 cut(s)	73
PspPI	GGNCC	1 cut(s)	91
SaqAI	TTAA	1 cut(s)	80
Sau3AI	GATC	4 cut(s)	7, 160, 193, 226
Sau96I	GGNCC	1 cut(s)	91
SetI	ASST	2 cut(s)	90, 177
SfaNI	GCATC	1 cut(s)	250
SsiI	CCGC	1 cut(s)	14
TaaI	ACNGT	1 cut(s)	64
TaqI	TCGA	1 cut(s)	273
Tru1I	TTAA	1 cut(s)	80
Tru9I	TTAA	1 cut(s)	80
TscAI	CASTG	1 cut(s)	190
TseFI	GTSAC	1 cut(s)	73
Tsp45I	GTSAC	1 cut(s)	73
TspDTI	ATGAA	1 cut(s)	69
TspGWI	ACGGA	1 cut(s)	121
TspRI	CASTG	1 cut(s)	190

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.