Rh1CG164200

Elongation factor

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1C
Physical Location & Seq
Forward (+)
36253785 .. 36254154
370 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1CG164200.1

Sequence Viewer

Length: 312 bp
ATGTATGATCAAGCGGGTTACGCTCTTTGGTTTTGCGATTACAAATACAACGATGAAAATACAGTCTCATTCGTGACTTTAAACAAGGTGGGCGGTTTTCTGCAACGGATGGATTTGCCTAGTAAATATGCGTTTGGGAAGATGTTGGTGATTGGGTCTGATCCTCCTTTCAAGGTGAAGGGCTTGTGGCTGTTCCGTGGGCAAGAGGTTGATATCACTGATGAGGATCAAAAGAAGCGTGTGAACCAGATGATTGAAGATCACGAGCCTTTTGAGGGGGAGGCTTTTTTGGATGCCAAATGCTTCGAGTGA

Protein Analysis

103

Amino Acids

12.01

Weight (kDa)

4.72

Isoelectric Point (pI)

48.77

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
EF1G PF00647 2 - 69 1.3e-24 Elongation factor 1 gamma, conserved domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 14, 93
AclWI GGATC 2 cut(s) 155, 234
AfiI CCNNNNNNNGG 1 cut(s) 275
AgsI TTSAA 2 cut(s) 172, 257
Alw26I GTCTC 1 cut(s) 70
AlwI GGATC 2 cut(s) 155, 234
AsuHPI GGTGA 2 cut(s) 160, 187
BauI CACGAG 1 cut(s) 263
BccI CCATC 1 cut(s) 103
BclI TGATCA 1 cut(s) 7
BcoDI GTCTC 1 cut(s) 70
BfaI CTAG 1 cut(s) 120
BmsI GCATC 1 cut(s) 283
BsaBI GATNNNNATC 1 cut(s) 225
BsaJI CCNNGG 1 cut(s) 196
Bsc4I CCNNNNNNNGG 1 cut(s) 275
Bse8I GATNNNNATC 1 cut(s) 225
BseDI CCNNGG 1 cut(s) 196
BseGI GGATG 2 cut(s) 114, 298
BseJI GATNNNNATC 1 cut(s) 225
BseLI CCNNNNNNNGG 1 cut(s) 275
BslI CCNNNNNNNGG 1 cut(s) 275
BsmAI GTCTC 1 cut(s) 70
Bsp143I GATC 4 cut(s) 7, 160, 226, 259
BspACI CCGC 2 cut(s) 14, 93
BspPI GGATC 2 cut(s) 155, 234
BssECI CCNNGG 1 cut(s) 196
BssMI GATC 4 cut(s) 7, 160, 226, 259
BssSI CACGAG 1 cut(s) 263
Bst2BI CACGAG 1 cut(s) 263
Bst4CI ACNGT 1 cut(s) 64
BstDSI CCRYGG 1 cut(s) 196
BstF5I GGATG 2 cut(s) 114, 298
BstKTI GATC 4 cut(s) 10, 163, 229, 262
BstMAI GTCTC 1 cut(s) 70
BstMBI GATC 4 cut(s) 7, 160, 226, 259
BstMWI GCNNNNNNNGC 1 cut(s) 20
BtgI CCRYGG 1 cut(s) 196
BtsCI GGATG 2 cut(s) 114, 298
BtsIMutI CAGTG 1 cut(s) 216
CviJI RGCY 4 cut(s) 183, 190, 268, 284
CviKI_1 RGCY 4 cut(s) 183, 190, 268, 284
DpnI GATC 4 cut(s) 9, 162, 228, 261
DpnII GATC 4 cut(s) 7, 160, 226, 259
DraI TTTAAA 1 cut(s) 81
Eco32I GATATC 1 cut(s) 214
EcoRV GATATC 1 cut(s) 214
FaiI YATR 2 cut(s) 6, 129
FauI CCCGC 1 cut(s) 7
FbaI TGATCA 1 cut(s) 7
FokI GGATG 2 cut(s) 121, 305
FspBI CTAG 1 cut(s) 120
HphI GGTGA 2 cut(s) 160, 187
Hpy166II GTNNAC 1 cut(s) 244
Hpy188I TCNGA 1 cut(s) 160
Hpy188III TCNNGA 2 cut(s) 73, 263
Hpy8I GTNNAC 1 cut(s) 244
HpyAV CCTTC 1 cut(s) 172
HpyCH4III ACNGT 1 cut(s) 64
HpyCH4V TGCA 1 cut(s) 103
HpyF10VI GCNNNNNNNGC 1 cut(s) 20
Ksp22I TGATCA 1 cut(s) 7
Kzo9I GATC 4 cut(s) 7, 160, 226, 259
LpnPI CCDG 1 cut(s) 260
LweI GCATC 1 cut(s) 283
MaeI CTAG 1 cut(s) 120
MaeIII GTNAC 2 cut(s) 17, 73
MalI GATC 4 cut(s) 9, 162, 228, 261
MboI GATC 4 cut(s) 7, 160, 226, 259
MboII GAAGA 2 cut(s) 151, 269
MnlI CCTC 5 cut(s) 174, 199, 217, 268, 274
MseI TTAA 1 cut(s) 80
MwoI GCNNNNNNNGC 1 cut(s) 20
NdeII GATC 4 cut(s) 7, 160, 226, 259
NmuCI GTSAC 1 cut(s) 73
SaqAI TTAA 1 cut(s) 80
Sau3AI GATC 4 cut(s) 7, 160, 226, 259
SetI ASST 3 cut(s) 90, 177, 210
SfaNI GCATC 1 cut(s) 283
SsiI CCGC 2 cut(s) 14, 93
SspMI CTAG 1 cut(s) 120
TaaI ACNGT 1 cut(s) 64
TaqI TCGA 1 cut(s) 306
Tru1I TTAA 1 cut(s) 80
Tru9I TTAA 1 cut(s) 80
TscAI CASTG 1 cut(s) 223
TseFI GTSAC 1 cut(s) 73
Tsp45I GTSAC 1 cut(s) 73
TspDTI ATGAA 1 cut(s) 69
TspGWI ACGGA 2 cut(s) 121, 185
TspRI CASTG 1 cut(s) 223
XspI CTAG 1 cut(s) 120
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.