Rh7AG409200

Elongation factor 1 gamma, conserved domain

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7A
Physical Location & Seq
Reverse (-)
54581217 .. 54581477
261 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7AG409200.1

Sequence Viewer

Length: 261 bp
ATGGATTTGGCTCGTAAGTATGCTTTTGGGAAGATGTTGGTGATTGGCTCTGAGCCTTCTTTCAAGGTGAAGGGCTTGTGGCTGTTCCACAGGCAAGAAATTCCCCAGTTCATAATGGATGAGTGTTATGACATGAAACTGTATGATTGGCGGAAGGTTGATATCACATATGAGGATCAAAAAGAGCGTGTGAATCAGATGATTGAAGATCATGAGCCCTTTGAGGGGGAGCCATTGTTGGATGCCAAATGTTTCAACTGA

Protein Analysis

86

Amino Acids

10.4

Weight (kDa)

4.94

Isoelectric Point (pI)

50.61

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 151
AclWI GGATC 1 cut(s) 183
AcsI RAATTY 1 cut(s) 99
AfiI CCNNNNNNNGG 2 cut(s) 224, 225
AgsI TTSAA 3 cut(s) 64, 206, 256
AlwI GGATC 1 cut(s) 183
ApoI RAATTY 1 cut(s) 99
AsuHPI GGTGA 2 cut(s) 52, 79
BanII GRGCYC 1 cut(s) 219
BmiI GGNNCC 1 cut(s) 231
BmrI ACTGGG 1 cut(s) 100
BmsI GCATC 1 cut(s) 232
BmuI ACTGGG 1 cut(s) 100
BsaXI ACNNNNNCTCC 2 cut(s) 221, 251
Bsc4I CCNNNNNNNGG 2 cut(s) 224, 225
Bse1I ACTGG 1 cut(s) 106
BseGI GGATG 2 cut(s) 124, 247
BseLI CCNNNNNNNGG 2 cut(s) 224, 225
BseMII CTCAG 1 cut(s) 42
BseNI ACTGG 1 cut(s) 106
BslI CCNNNNNNNGG 2 cut(s) 224, 225
Bsp1286I GDGCHC 1 cut(s) 219
Bsp143I GATC 2 cut(s) 175, 208
BspACI CCGC 1 cut(s) 151
BspCNI CTCAG 1 cut(s) 43
BspHI TCATGA 1 cut(s) 211
BspLI GGNNCC 1 cut(s) 231
BspPI GGATC 1 cut(s) 183
BsrI ACTGG 1 cut(s) 106
BssMI GATC 2 cut(s) 175, 208
Bst4CI ACNGT 1 cut(s) 141
BstDEI CTNAG 1 cut(s) 51
BstF5I GGATG 2 cut(s) 124, 247
BstKTI GATC 2 cut(s) 178, 211
BstMBI GATC 2 cut(s) 175, 208
BtsCI GGATG 2 cut(s) 124, 247
CciI TCATGA 1 cut(s) 211
CviAII CATG 2 cut(s) 133, 212
CviJI RGCY 7 cut(s) 11, 48, 55, 75, 82, 217, 232
CviKI_1 RGCY 7 cut(s) 11, 48, 55, 75, 82, 217, 232
DdeI CTNAG 1 cut(s) 51
DpnI GATC 2 cut(s) 177, 210
DpnII GATC 2 cut(s) 175, 208
EciI GGCGGA 1 cut(s) 166
Eco24I GRGCYC 1 cut(s) 219
Eco32I GATATC 1 cut(s) 163
EcoRV GATATC 1 cut(s) 163
EcoT38I GRGCYC 1 cut(s) 219
FaeI CATG 2 cut(s) 136, 215
FaiI YATR 8 cut(s) 21, 113, 129, 134, 144, 169, 171, 213
FatI CATG 2 cut(s) 132, 211
FauNDI CATATG 1 cut(s) 169
FokI GGATG 2 cut(s) 131, 254
FriOI GRGCYC 1 cut(s) 219
Hin1II CATG 2 cut(s) 136, 215
HinfI GANTC 1 cut(s) 193
HphI GGTGA 2 cut(s) 52, 79
Hpy188I TCNGA 2 cut(s) 52, 198
Hpy188III TCNNGA 1 cut(s) 212
HpyAV CCTTC 3 cut(s) 64, 66, 148
HpyCH4III ACNGT 1 cut(s) 141
HpyF3I CTNAG 1 cut(s) 51
Hsp92II CATG 2 cut(s) 136, 215
Kzo9I GATC 2 cut(s) 175, 208
LmnI GCTCC 1 cut(s) 229
LpnPI CCDG 2 cut(s) 76, 119
LweI GCATC 1 cut(s) 232
MalI GATC 2 cut(s) 177, 210
MboI GATC 2 cut(s) 175, 208
MboII GAAGA 2 cut(s) 43, 218
MhlI GDGCHC 1 cut(s) 219
MluCI AATT 1 cut(s) 99
MmeI TCCRAC 1 cut(s) 219
MnlI CCTC 2 cut(s) 166, 217
NdeI CATATG 1 cut(s) 169
NdeII GATC 2 cut(s) 175, 208
NlaIII CATG 2 cut(s) 136, 215
NlaIV GGNNCC 1 cut(s) 231
PagI TCATGA 1 cut(s) 211
PfeI GAWTC 1 cut(s) 193
PspN4I GGNNCC 1 cut(s) 231
Sau3AI GATC 2 cut(s) 175, 208
SduI GDGCHC 1 cut(s) 219
SetI ASST 2 cut(s) 69, 159
SfaNI GCATC 1 cut(s) 232
SgeI CNNG 9 cut(s) 24, 76, 88, 103, 107, 118, 145, 200, 224
Sse9I AATT 1 cut(s) 99
SsiI CCGC 1 cut(s) 151
TaaI ACNGT 1 cut(s) 141
TasI AATT 1 cut(s) 99
TfiI GAWTC 1 cut(s) 193
TspDTI ATGAA 2 cut(s) 100, 149
XapI RAATTY 1 cut(s) 99
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.