Rmu_sc0004110.1_g000010

Elongation factor 1 gamma, conserved domain

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0004110.1
Physical Location & Seq
Reverse (-)
34850 .. 35251
402 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0004110.1_g000010.1.cds

Sequence Viewer

Length: 402 bp
atgtatgatcccgaaggttactctctttggttttgcgagtacaagtacaatgatgaaaatactgtttcattcgtcactctgaataaggtgggcggttttctacagcaaatggatttggctcgtaagtatgcttttgggaagatgttggtgattggctctgagccttctttcaaggtgaagggcttgtggctgttccacaggcaagaaattccgcagttcataatggatgagtgttatgacatgaaactgtatgattggcggaaggttgatatcacatatgaggatcaaaaagagcgtgtgaatcagatgattgaagatcataagccctttgaggggggagccattgttgaatgccaaatttttcaactgatgggaataggtttttccaagaggttaatgtaa

Protein Analysis

133

Amino Acids

15.86

Weight (kDa)

5.2

Isoelectric Point (pI)

49.41

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 3 cut(s) 93, 212, 259
AclWI GGATC 2 cut(s) 2, 291
AcsI RAATTY 2 cut(s) 207, 357
AfaI GTAC 2 cut(s) 41, 47
AfiI CCNNNNNNNGG 2 cut(s) 332, 333
AgsI TTSAA 4 cut(s) 172, 314, 350, 365
AlwI GGATC 2 cut(s) 2, 291
ApoI RAATTY 2 cut(s) 207, 357
AsuHPI GGTGA 2 cut(s) 160, 187
BccI CCATC 1 cut(s) 364
BfmI CTRYAG 1 cut(s) 101
BmiI GGNNCC 1 cut(s) 340
BsaXI ACNNNNNCTCC 2 cut(s) 330, 360
Bsc4I CCNNNNNNNGG 2 cut(s) 332, 333
BseGI GGATG 1 cut(s) 232
BseLI CCNNNNNNNGG 2 cut(s) 332, 333
BseMII CTCAG 1 cut(s) 150
BslI CCNNNNNNNGG 2 cut(s) 332, 333
BsmI GAATGC 1 cut(s) 356
Bsp143I GATC 3 cut(s) 7, 283, 316
BspACI CCGC 3 cut(s) 93, 212, 259
BspCNI CTCAG 1 cut(s) 151
BspLI GGNNCC 1 cut(s) 340
BspPI GGATC 2 cut(s) 2, 291
BssMI GATC 3 cut(s) 7, 283, 316
Bst4CI ACNGT 2 cut(s) 64, 249
BstDEI CTNAG 1 cut(s) 159
BstF5I GGATG 1 cut(s) 232
BstKTI GATC 3 cut(s) 10, 286, 319
BstMBI GATC 3 cut(s) 7, 283, 316
BstSFI CTRYAG 1 cut(s) 101
BtsCI GGATG 1 cut(s) 232
Csp6I GTAC 2 cut(s) 40, 46
CviAII CATG 1 cut(s) 241
CviJI RGCY 7 cut(s) 119, 156, 163, 183, 190, 325, 341
CviKI_1 RGCY 7 cut(s) 119, 156, 163, 183, 190, 325, 341
CviQI GTAC 2 cut(s) 40, 46
DdeI CTNAG 1 cut(s) 159
DpnI GATC 3 cut(s) 9, 285, 318
DpnII GATC 3 cut(s) 7, 283, 316
EciI GGCGGA 1 cut(s) 274
Eco32I GATATC 1 cut(s) 271
EcoRV GATATC 1 cut(s) 271
FaeI CATG 1 cut(s) 244
FaiI YATR 9 cut(s) 6, 129, 221, 237, 242, 252, 277, 279, 321
FatI CATG 1 cut(s) 240
FauNDI CATATG 1 cut(s) 277
FokI GGATG 1 cut(s) 239
Hin1II CATG 1 cut(s) 244
HinfI GANTC 1 cut(s) 301
HphI GGTGA 2 cut(s) 160, 187
Hpy188I TCNGA 3 cut(s) 81, 160, 306
Hpy188III TCNNGA 1 cut(s) 11
HpyAV CCTTC 4 cut(s) 8, 172, 174, 256
HpyCH4III ACNGT 2 cut(s) 64, 249
HpyF3I CTNAG 1 cut(s) 159
Hsp92II CATG 1 cut(s) 244
Kzo9I GATC 3 cut(s) 7, 283, 316
LmnI GCTCC 1 cut(s) 338
LpnPI CCDG 1 cut(s) 184
MaeIII GTNAC 2 cut(s) 17, 73
MalI GATC 3 cut(s) 9, 285, 318
MboI GATC 3 cut(s) 7, 283, 316
MboII GAAGA 2 cut(s) 151, 326
MluCI AATT 2 cut(s) 207, 357
MnlI CCTC 3 cut(s) 274, 325, 384
MseI TTAA 1 cut(s) 395
Mva1269I GAATGC 1 cut(s) 356
NdeI CATATG 1 cut(s) 277
NdeII GATC 3 cut(s) 7, 283, 316
NlaIII CATG 1 cut(s) 244
NlaIV GGNNCC 1 cut(s) 340
NmuCI GTSAC 1 cut(s) 73
PctI GAATGC 1 cut(s) 356
PfeI GAWTC 1 cut(s) 301
PspN4I GGNNCC 1 cut(s) 340
RsaI GTAC 2 cut(s) 41, 47
RsaNI GTAC 2 cut(s) 40, 46
SaqAI TTAA 1 cut(s) 395
Sau3AI GATC 3 cut(s) 7, 283, 316
SetI ASST 6 cut(s) 19, 90, 177, 267, 382, 395
SfcI CTRYAG 1 cut(s) 101
Sse9I AATT 2 cut(s) 207, 357
SsiI CCGC 3 cut(s) 93, 212, 259
TaaI ACNGT 2 cut(s) 64, 249
TasI AATT 2 cut(s) 207, 357
TatI WGTACW 2 cut(s) 39, 45
TfiI GAWTC 1 cut(s) 301
Tru1I TTAA 1 cut(s) 395
Tru9I TTAA 1 cut(s) 395
TseFI GTSAC 1 cut(s) 73
Tsp45I GTSAC 1 cut(s) 73
TspDTI ATGAA 4 cut(s) 57, 69, 208, 257
XapI RAATTY 2 cut(s) 207, 357
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.