Rroxscaffold_4G00311400

Elongation factor

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000004
Physical Location & Seq
Reverse (-)
33949276 .. 33950451
1176 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_4G00311400.1

Sequence Viewer

Length: 279 bp
ATGTATGATCAAGCGGGTTACGCTCTTTGGTTTTGCGATTACAAATACAACGATGAAAATACAGTCTCACTCGTGACTTTAAACAAGGTGGGCGGTTTTCTGCAACGGATGGATTTGCCTCGTAAATATGCGTTTGGGAAGATGTTGGTGATTGGGTCTGATCCTCCTTTCAAGGTGAAGGGCTTGTGGCTGTTCCGTGGGCAAGAGGTTCCCCAGATGATTGAAGATCACAAGCCTTTTGAAGGGGAGGCTTTTTTGGATGCCAAATGCCTCGAGTGA

Protein Analysis

92

Amino Acids

10.66

Weight (kDa)

5.35

Isoelectric Point (pI)

53.25

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
EF1G PF00647 2 - 69 3.2e-24 Elongation factor 1 gamma, conserved domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 14, 93
AclWI GGATC 1 cut(s) 155
AfiI CCNNNNNNNGG 1 cut(s) 242
AgsI TTSAA 3 cut(s) 172, 224, 242
Alw26I GTCTC 1 cut(s) 70
AlwI GGATC 1 cut(s) 155
Ama87I CYCGRG 1 cut(s) 272
AsuHPI GGTGA 2 cut(s) 160, 187
AvaI CYCGRG 1 cut(s) 272
BauI CACGAG 1 cut(s) 71
BccI CCATC 1 cut(s) 103
BclI TGATCA 1 cut(s) 7
BcoDI GTCTC 1 cut(s) 70
BmeT110I CYCGRG 1 cut(s) 272
BmiI GGNNCC 1 cut(s) 210
BmsI GCATC 1 cut(s) 250
BsaJI CCNNGG 1 cut(s) 196
Bsc4I CCNNNNNNNGG 1 cut(s) 242
BseDI CCNNGG 1 cut(s) 196
BseGI GGATG 2 cut(s) 114, 265
BseLI CCNNNNNNNGG 1 cut(s) 242
BsiHKCI CYCGRG 1 cut(s) 272
BslI CCNNNNNNNGG 1 cut(s) 242
BsmAI GTCTC 1 cut(s) 70
BsoBI CYCGRG 1 cut(s) 272
Bsp143I GATC 3 cut(s) 7, 160, 226
BspACI CCGC 2 cut(s) 14, 93
BspLI GGNNCC 1 cut(s) 210
BspPI GGATC 1 cut(s) 155
BssECI CCNNGG 1 cut(s) 196
BssMI GATC 3 cut(s) 7, 160, 226
BssSI CACGAG 1 cut(s) 71
Bst2BI CACGAG 1 cut(s) 71
Bst4CI ACNGT 1 cut(s) 64
BstDSI CCRYGG 1 cut(s) 196
BstENI CCTNNNNNAGG 1 cut(s) 240
BstF5I GGATG 2 cut(s) 114, 265
BstKTI GATC 3 cut(s) 10, 163, 229
BstMAI GTCTC 1 cut(s) 70
BstMBI GATC 3 cut(s) 7, 160, 226
BstMWI GCNNNNNNNGC 1 cut(s) 20
BtgI CCRYGG 1 cut(s) 196
BtsCI GGATG 2 cut(s) 114, 265
CviJI RGCY 4 cut(s) 183, 190, 235, 251
CviKI_1 RGCY 4 cut(s) 183, 190, 235, 251
DpnI GATC 3 cut(s) 9, 162, 228
DpnII GATC 3 cut(s) 7, 160, 226
DraI TTTAAA 1 cut(s) 81
Eco88I CYCGRG 1 cut(s) 272
EcoNI CCTNNNNNAGG 1 cut(s) 240
FaiI YATR 2 cut(s) 6, 129
FauI CCCGC 1 cut(s) 7
FbaI TGATCA 1 cut(s) 7
FokI GGATG 2 cut(s) 121, 272
HphI GGTGA 2 cut(s) 160, 187
Hpy188I TCNGA 1 cut(s) 160
Hpy188III TCNNGA 1 cut(s) 73
HpyAV CCTTC 2 cut(s) 172, 236
HpyCH4III ACNGT 1 cut(s) 64
HpyCH4V TGCA 1 cut(s) 103
HpyF10VI GCNNNNNNNGC 1 cut(s) 20
Ksp22I TGATCA 1 cut(s) 7
Kzo9I GATC 3 cut(s) 7, 160, 226
LpnPI CCDG 1 cut(s) 227
LweI GCATC 1 cut(s) 250
MaeIII GTNAC 2 cut(s) 17, 73
MalI GATC 3 cut(s) 9, 162, 228
MboI GATC 3 cut(s) 7, 160, 226
MboII GAAGA 2 cut(s) 151, 236
MnlI CCTC 4 cut(s) 129, 174, 199, 241
MseI TTAA 1 cut(s) 80
MwoI GCNNNNNNNGC 1 cut(s) 20
NdeII GATC 3 cut(s) 7, 160, 226
NlaIV GGNNCC 1 cut(s) 210
NmuCI GTSAC 1 cut(s) 73
PaeR7I CTCGAG 1 cut(s) 272
PspN4I GGNNCC 1 cut(s) 210
PspXI VCTCGAGB 1 cut(s) 272
SaqAI TTAA 1 cut(s) 80
Sau3AI GATC 3 cut(s) 7, 160, 226
SetI ASST 3 cut(s) 90, 177, 210
SfaNI GCATC 1 cut(s) 250
Sfr274I CTCGAG 1 cut(s) 272
SlaI CTCGAG 1 cut(s) 272
SmlI CTYRAG 1 cut(s) 272
SmoI CTYRAG 1 cut(s) 272
SsiI CCGC 2 cut(s) 14, 93
TaaI ACNGT 1 cut(s) 64
TaqI TCGA 1 cut(s) 273
Tru1I TTAA 1 cut(s) 80
Tru9I TTAA 1 cut(s) 80
TseFI GTSAC 1 cut(s) 73
Tsp45I GTSAC 1 cut(s) 73
TspDTI ATGAA 1 cut(s) 69
TspGWI ACGGA 2 cut(s) 121, 185
XagI CCTNNNNNAGG 1 cut(s) 240
XhoI CTCGAG 1 cut(s) 272
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.