Rmu_sc0001548.1_g000020

Ribosomal protein-like protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001548.1
OG0003288
Physical Location & Seq
Forward (+)
89317 .. 90368
1052 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 966 bp
atgcgaagcgccaagtctcttcaaagtcgattttctgatcttaactattgcgtaagcaaatttcgtggttcacttcgccaggtggaaaatcggaatcaaagtggtgcttcagagaaagatatttatgcccagacaaaacaacatctactagatgatcctaactatacaaagaagaagtttcaattagatcatgtgtggcctattctcaaggatgctgaaaaatggaccaataatggtagaagttcaactaaaccacgacaaaaaaattactcaagtgaaggatatgaatcaacgtctcgcacatcacaatcgtcaggtacattaccagttgatgtcaatttgaatgcaaatgaagacgaacaagagctgtttagtgatgaacttgcctcacctcaccggcctattggtgtaaagaaagcaaagctgaaaaggaaagagttgaacgagaagactaagattgctcaacaagtgaaaaaatccaaccaagaactgaaggagttacttgaaaaaaacttgttggagagaaatgatttttcctctaagcatgaggaatatgcatctcaaaaattagctattcaacgtcaacgtaaggagaccaagatcatgcttactagtttggattcaattacagatccaaaaggacgtgagtacttacgaatgaaaaaaactgaaataatggagagaagagctcgtgagtcccaactacaacaatcacctgcaacatttggctatggtaattttggatatggacaacactatggaggaggaagtggtggatatggacaacattatggaggaacagctggatatggtgaaattcctcattatggaggaagtggtggatctggaacaattggtgcacatgcaggagtgcaacaattcggtggtagcaatagatccaatacacatggcggatatggaggaatgccagaacatggaggaagtaatgatagtctaccggaataa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Plant_tran

Protein Analysis

321

Amino Acids

35.83

Weight (kDa)

9.36

Isoelectric Point (pI)

48.73

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
NAM-associated PF14303 58 - 225 2.2e-19 No apical meristem-associated C-terminal domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 724
Acc36I ACCTGC 1 cut(s) 724
AccB7I CCANNNNNTGG 1 cut(s) 935
AccI GTMKAC 1 cut(s) 955
AciI CCGC 1 cut(s) 912
AclWI GGATC 4 cut(s) 149, 626, 850, 891
AcsI RAATTY 2 cut(s) 59, 816
AcuI CTGAAG 2 cut(s) 93, 512
AfaI GTAC 2 cut(s) 319, 650
AfiI CCNNNNNNNGG 2 cut(s) 827, 935
AgsI TTSAA 8 cut(s) 23, 182, 246, 343, 442, 506, 578, 624
AhlI ACTAGT 1 cut(s) 611
AjiI CACGTC 1 cut(s) 644
AjnI CCWGG 1 cut(s) 78
AluBI AGCT 5 cut(s) 367, 424, 572, 689, 803
AluI AGCT 5 cut(s) 367, 424, 572, 689, 803
Alw21I GWGCWC 2 cut(s) 691, 862
Alw26I GTCTC 3 cut(s) 21, 300, 587
Alw44I GTGCAC 1 cut(s) 858
AlwI GGATC 4 cut(s) 149, 626, 850, 891
AoxI GGCC 2 cut(s) 197, 398
ApaLI GTGCAC 1 cut(s) 858
ApoI RAATTY 2 cut(s) 59, 816
AspLEI GCGC 1 cut(s) 11
AspS9I GGNCC 1 cut(s) 225
AsuHPI GGTGA 4 cut(s) 381, 386, 705, 824
AvaII GGWCC 1 cut(s) 225
BaeGI GKGCMC 1 cut(s) 862
BanII GRGCYC 1 cut(s) 691
BauI CACGAG 1 cut(s) 690
BbsI GAAGAC 2 cut(s) 360, 455
Bbv12I GWGCWC 2 cut(s) 691, 862
BciT130I CCWGG 1 cut(s) 80
BcoDI GTCTC 3 cut(s) 21, 300, 587
BcuI ACTAGT 1 cut(s) 611
BfaI CTAG 2 cut(s) 149, 612
BfoI RGCGCY 1 cut(s) 12
BfuAI ACCTGC 1 cut(s) 724
BmcAI AGTACT 1 cut(s) 650
Bme1390I CCNGG 1 cut(s) 80
Bme18I GGWCC 1 cut(s) 225
BmgBI CACGTC 1 cut(s) 644
BmgT120I GGNCC 1 cut(s) 225
BmrFI CCNGG 1 cut(s) 80
BmsI GCATC 2 cut(s) 202, 566
BpiI GAAGAC 2 cut(s) 360, 455
BplI GAGNNNNNCTC 2 cut(s) 673, 705
BpuEI CTTGAG 2 cut(s) 191, 256
BsaBI GATNNNNATC 1 cut(s) 286
BsaI GGTCTC 1 cut(s) 587
BsaWI WCCGGW 1 cut(s) 958
Bsc4I CCNNNNNNNGG 2 cut(s) 827, 935
Bse118I RCCGGY 1 cut(s) 396
Bse1I ACTGG 1 cut(s) 326
Bse8I GATNNNNATC 1 cut(s) 286
BseBI CCWGG 1 cut(s) 80
BseGI GGATG 1 cut(s) 217
BseJI GATNNNNATC 1 cut(s) 286
BseLI CCNNNNNNNGG 2 cut(s) 827, 935
BseNI ACTGG 1 cut(s) 326
BseRI GAGGAG 1 cut(s) 777
BseSI GKGCMC 1 cut(s) 862
BshFI GGCC 2 cut(s) 199, 400
BsiHKAI GWGCWC 2 cut(s) 691, 862
BsiSI CCGG 2 cut(s) 397, 959
BslFI GGGAC 1 cut(s) 682
BslI CCNNNNNNNGG 2 cut(s) 827, 935
BsmAI GTCTC 3 cut(s) 21, 300, 587
BsmBI CGTCTC 1 cut(s) 300
BsmFI GGGAC 1 cut(s) 682
BsmI GAATGC 2 cut(s) 349, 930
BsnI GGCC 2 cut(s) 199, 400
Bso31I GGTCTC 1 cut(s) 587
Bsp1286I GDGCHC 2 cut(s) 691, 862
Bsp143I GATC 7 cut(s) 37, 154, 187, 600, 631, 842, 896
BspACI CCGC 1 cut(s) 912
BspANI GGCC 2 cut(s) 199, 400
BspMI ACCTGC 1 cut(s) 724
BspPI GGATC 4 cut(s) 149, 626, 850, 891
BspQI GCTCTTC 1 cut(s) 679
BspTNI GGTCTC 1 cut(s) 587
BsrFI RCCGGY 1 cut(s) 396
BsrI ACTGG 1 cut(s) 326
BssAI RCCGGY 1 cut(s) 396
BssMI GATC 7 cut(s) 37, 154, 187, 600, 631, 842, 896
BssSI CACGAG 1 cut(s) 690
Bst2BI CACGAG 1 cut(s) 690
Bst2UI CCWGG 1 cut(s) 80
Bst6I CTCTTC 2 cut(s) 24, 679
BstDEI CTNAG 2 cut(s) 453, 540
BstF5I GGATG 1 cut(s) 217
BstH2I RGCGCY 1 cut(s) 12
BstHHI GCGC 1 cut(s) 11
BstKTI GATC 7 cut(s) 40, 157, 190, 603, 634, 845, 899
BstMAI GTCTC 3 cut(s) 21, 300, 587
BstMBI GATC 7 cut(s) 37, 154, 187, 600, 631, 842, 896
BstNI CCWGG 1 cut(s) 80
BstNSI RCATGY 1 cut(s) 866
BstSCI CCNGG 1 cut(s) 78
BstSLI GKGCMC 1 cut(s) 862
BstV2I GAAGAC 2 cut(s) 360, 455
BstX2I RGATCY 3 cut(s) 631, 842, 896
BstYI RGATCY 3 cut(s) 631, 842, 896
BsuRI GGCC 2 cut(s) 199, 400
BtrI CACGTC 1 cut(s) 644
BtsCI GGATG 1 cut(s) 217
BveI ACCTGC 1 cut(s) 724
CfoI GCGC 1 cut(s) 11
Cfr10I RCCGGY 1 cut(s) 396
Cfr13I GGNCC 1 cut(s) 225
Csp6I GTAC 2 cut(s) 318, 649
CspCI CAANNNNNGTGG 2 cut(s) 46, 81
CviAII CATG 6 cut(s) 191, 545, 604, 863, 908, 935
CviJI RGCY 8 cut(s) 199, 367, 400, 424, 572, 689, 729, 803
CviKI_1 RGCY 8 cut(s) 199, 367, 400, 424, 572, 689, 729, 803
CviQI GTAC 2 cut(s) 318, 649
DdeI CTNAG 2 cut(s) 453, 540
DpnI GATC 7 cut(s) 39, 156, 189, 602, 633, 844, 898
DpnII GATC 7 cut(s) 37, 154, 187, 600, 631, 842, 896
Eam1104I CTCTTC 2 cut(s) 24, 679
EarI CTCTTC 2 cut(s) 24, 679
EciI GGCGGA 1 cut(s) 927
Ecl136II GAGCTC 1 cut(s) 689
Eco24I GRGCYC 1 cut(s) 691
Eco31I GGTCTC 1 cut(s) 587
Eco47I GGWCC 1 cut(s) 225
Eco53kI GAGCTC 1 cut(s) 689
Eco57I CTGAAG 2 cut(s) 93, 512
EcoICRI GAGCTC 1 cut(s) 689
EcoRII CCWGG 1 cut(s) 78
EcoT22I ATGCAT 1 cut(s) 559
EcoT38I GRGCYC 1 cut(s) 691
Esp3I CGTCTC 1 cut(s) 300
FaeI CATG 6 cut(s) 194, 548, 607, 866, 911, 938
FalI AAGNNNNNCTT 2 cut(s) 91, 123
FaqI GGGAC 1 cut(s) 682
FatI CATG 6 cut(s) 190, 544, 603, 862, 907, 934
FblI GTMKAC 1 cut(s) 955
FokI GGATG 1 cut(s) 224
FriOI GRGCYC 1 cut(s) 691
FspBI CTAG 2 cut(s) 149, 612
GlaI GCGC 1 cut(s) 10
HaeII RGCGCY 1 cut(s) 12
HaeIII GGCC 2 cut(s) 199, 400
HapII CCGG 2 cut(s) 397, 959
HhaI GCGC 1 cut(s) 11
Hin1II CATG 6 cut(s) 194, 548, 607, 866, 911, 938
Hin6I GCGC 1 cut(s) 9
HinP1I GCGC 1 cut(s) 9
HincII GTYRAC 1 cut(s) 584
HindII GTYRAC 1 cut(s) 584
HinfI GANTC 4 cut(s) 94, 287, 620, 695
HpaII CCGG 2 cut(s) 397, 959
HphI GGTGA 4 cut(s) 381, 386, 705, 824
Hpy166II GTNNAC 4 cut(s) 71, 584, 860, 956
Hpy188I TCNGA 3 cut(s) 37, 93, 112
Hpy188III TCNNGA 2 cut(s) 692, 846
Hpy8I GTNNAC 4 cut(s) 71, 584, 860, 956
HpyAV CCTTC 2 cut(s) 272, 487
HpyCH4IV ACGT 4 cut(s) 293, 580, 586, 643
HpyCH4V TGCA 6 cut(s) 347, 557, 719, 860, 866, 874
HpyF3I CTNAG 2 cut(s) 453, 540
HpySE526I ACGT 4 cut(s) 293, 580, 586, 643
Hsp92II CATG 6 cut(s) 194, 548, 607, 866, 911, 938
HspAI GCGC 1 cut(s) 9
Kzo9I GATC 7 cut(s) 37, 154, 187, 600, 631, 842, 896
LguI GCTCTTC 1 cut(s) 679
LweI GCATC 2 cut(s) 202, 566
MaeI CTAG 2 cut(s) 149, 612
MaeII ACGT 4 cut(s) 293, 580, 586, 643
MaeIII GTNAC 1 cut(s) 498
MalI GATC 7 cut(s) 39, 156, 189, 602, 633, 844, 898
MboI GATC 7 cut(s) 37, 154, 187, 600, 631, 842, 896
MboII GAAGA 5 cut(s) 11, 184, 365, 460, 696
MfeI CAATTG 1 cut(s) 852
MflI RGATCY 3 cut(s) 631, 842, 896
MhlI GDGCHC 2 cut(s) 691, 862
MlyI GAGTC 1 cut(s) 704
MmeI TCCRAC 2 cut(s) 498, 504
Mph1103I ATGCAT 1 cut(s) 559
MseI TTAA 1 cut(s) 42
MspA1I CMGCKG 1 cut(s) 803
MspI CCGG 2 cut(s) 397, 959
MspR9I CCNGG 1 cut(s) 80
MunI CAATTG 1 cut(s) 852
Mva1269I GAATGC 2 cut(s) 349, 930
MvaI CCWGG 1 cut(s) 80
NdeII GATC 7 cut(s) 37, 154, 187, 600, 631, 842, 896
NlaIII CATG 6 cut(s) 194, 548, 607, 866, 911, 938
NsiI ATGCAT 1 cut(s) 559
NspI RCATGY 1 cut(s) 866
PaqCI CACCTGC 1 cut(s) 724
PciSI GCTCTTC 1 cut(s) 679
PctI GAATGC 2 cut(s) 349, 930
PfeI GAWTC 3 cut(s) 94, 287, 620
PflMI CCANNNNNTGG 1 cut(s) 935
PleI GAGTC 1 cut(s) 703
PpsI GAGTC 1 cut(s) 703
Psp124BI GAGCTC 1 cut(s) 691
Psp6I CCWGG 1 cut(s) 78
PspGI CCWGG 1 cut(s) 78
PspPI GGNCC 1 cut(s) 225
PsuI RGATCY 3 cut(s) 631, 842, 896
PvuII CAGCTG 1 cut(s) 803
RsaI GTAC 2 cut(s) 319, 650
RsaNI GTAC 2 cut(s) 318, 649
SacI GAGCTC 1 cut(s) 691
SapI GCTCTTC 1 cut(s) 679
SaqAI TTAA 1 cut(s) 42
Sau3AI GATC 7 cut(s) 37, 154, 187, 600, 631, 842, 896
Sau96I GGNCC 1 cut(s) 225
ScaI AGTACT 1 cut(s) 650
SchI GAGTC 1 cut(s) 704
ScrFI CCNGG 1 cut(s) 80
SduI GDGCHC 2 cut(s) 691, 862
SfaNI GCATC 2 cut(s) 202, 566
SinI GGWCC 1 cut(s) 225
SmlI CTYRAG 2 cut(s) 206, 271
SmoI CTYRAG 2 cut(s) 206, 271
SpeI ACTAGT 1 cut(s) 611
SsiI CCGC 1 cut(s) 912
SspMI CTAG 2 cut(s) 149, 612
SstI GAGCTC 1 cut(s) 691
StyD4I CCNGG 1 cut(s) 78
TaiI ACGT 4 cut(s) 296, 583, 589, 646
TaqI TCGA 1 cut(s) 28
TatI WGTACW 1 cut(s) 648
TfiI GAWTC 3 cut(s) 94, 287, 620
Tru1I TTAA 1 cut(s) 42
Tru9I TTAA 1 cut(s) 42
TspDTI ATGAA 4 cut(s) 300, 366, 393, 674
Van91I CCANNNNNTGG 1 cut(s) 935
VneI GTGCAC 1 cut(s) 858
VpaK11BI GGWCC 1 cut(s) 225
XapI RAATTY 2 cut(s) 59, 816
XceI RCATGY 1 cut(s) 866
XmiI GTMKAC 1 cut(s) 955
XspI CTAG 2 cut(s) 149, 612
ZrmI AGTACT 1 cut(s) 650
Zsp2I ATGCAT 1 cut(s) 559
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.