Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0001639.1

Orthogroup ID

OG0002940

Physical Location & Seq

Genomic Coordinates Reverse (-)

131389 .. 133678

Gene Structure 2290 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0001639.1_g000031.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1719 bp

atggatgggaacatgtttagtgatgtgaatggccaatatgatccaaaaccggaattccatgtttatgatatagtatgggggaaagtaaggggttatccctggtggcctggacggatatgtgatccttcagcttcatcgaatgaggcaaagatgcttttcagaaagggtagttatttgatagattattttggggatcactcatttacttggaatgaagcaccacatattaagccctttctggattatttctcacaaatggagaagcagagtaataaggacgaattccaaaatgccattgcttgtgctctggacgaattcttaagacgggtagagttgggggtggtctgttcttgcatatctggagaggtatatccaaaactcaaaaatcagataattattagtgatggagtcaagcaagaagaagaagaagaagaagaagaagaagaagacagtggaaatgctggtgacggttcccttaccgccgtctcttttgagcctcagaaactcattatgcttctaaaggagtttgctcagttttcatatggaaaagctgaccaactagaactttcaacatcagtgatccaattatcagctttctattgttggaagagttctcagctgtcgctgccaacggagaatgatgcctatatatcagtattgggggagaagactcgatgcaatgtattaggtcacaattcacttccagtaactacagatgagaagctggtgcagaagtctaaaagtaaagctaacaacaatgatctgggatgttgtgcaacattatggctggtgaagaagcaacgcacaattcacacccgcaggaataaaatcctggttccgcccttgtgtttgtctattccaatgactgataatgcagcagaaggggaagctagtggtttggttgttttaccttccatgagtgagaatacatcagaaggggaaactagaagtaaattgattttgcaatcttctgatgagaatccagaggaagttgatgctatagcggatgaagatgtgacgacagtaagtgaagctgcacttccagtaacaaaggatgtgaaattggtgtggaaatcagaaggtaaagataactcattgcacaagtgtaatctcatgtctgagtgcagtatgaattcgagtgaaaaggagaaaatattgtcagatttaaaggcttataagtgtttgtctactccaatgtgtcagaacggattggaagggaaagcaggcagtaaattgactttgcaatcctgtgtaaagcgcaaggcagttgatgttatggctgatgactttgcgctgaaacataggaaaagtgattcatcaacaaggactaaagatgcacttctgctaactgaggatgagatgttagtgaggaaaaccgaaagtaaaaggaactcgatgcataagtgcaagcgcatatatagagataaaatgaatccaagtaaagaacagaaaagcttatcggatttaaatggtgagaagtgtttgtctccaacaagtgagtatagattaccttctgatcatacattgactttgcactcctctagtagtatacaaaaggaagttgatcctatagctgatgactctgcactggaagattgggaaagctatttatcagcaggggatgttaagcagtcttttggagtcgcagattttattaacatgtttctacagagggagcacacttctggagctggagaaaggatctgtctggttgaatga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

PWWP

Protein Analysis

572

Amino Acids

64.01

Weight (kDa)

5.12

Isoelectric Point (pI)

48.82

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002940)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G09670 AT3G09670 AT5G02950 AT5G02950
fragaria_vesca	FvH4_6g15300 FvH4_6g15320 FvH4_6g15320
malus_domestica	MD12G1124400.v1.1
prunus_persica	Prupe.6G241400_v2.0.a1
pyrus_communis	pycom12g12280
rosa_chinensis	RchiOBHm_Chr3g0468721 RchiOBHm_Chr3g0468761 RchiOBHm_Chr3g0468791
rosa_laevigata	RLG00000024409 RLG00000024412 RLG00000024413
rosa_multiflora	Rmu_sc0001639.1_g000025 Rmu_sc0001639.1_g000031 Rmu_sc0001639.1_g000033
rosa_roxburghii	Rroxscaffold_6G00412560 Rroxscaffold_6G00412620 Rroxscaffold_6G00412630
rosa_rugosa	Rorug03G0096300 Rorug03G0096400 Rorug03G0096500
rosa_samantha	Rh3AG145400 Rh3AG145500 Rh3AG146200 Rh3BG168100 Rh3BG168300 Rh3BG168400 Rh3BG168800 Rh3DG166700 Rh3DG166800 Rh3DG167100
rosa_wichuraiana	Rw3G013710 Rw3G013720 Rw3G013750

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	1176
AccI	GTMKAC	2 cut(s)	1187, 1549
AciI	CCGC	4 cut(s)	480, 817, 839, 1004
AclWI	GGATC	6 cut(s)	35, 116, 201, 574, 1559, 1709
AcoI	YGGCCR	1 cut(s)	31
AcsI	RAATTY	4 cut(s)	53, 281, 314, 1132
AcuI	CTGAAG	1 cut(s)	111
AflII	CTTAAG	1 cut(s)	319
AflIII	ACRYGT	2 cut(s)	12, 1659
AgsI	TTSAA	2 cut(s)	570, 1715
AjnI	CCWGG	3 cut(s)	98, 106, 831
Alw21I	GWGCWC	2 cut(s)	307, 1680
Alw26I	GTCTC	2 cut(s)	490, 1491
AlwI	GGATC	6 cut(s)	35, 116, 201, 574, 1559, 1709
AoxI	GGCC	2 cut(s)	31, 104
ApeKI	GCWGC	3 cut(s)	625, 875, 1034
ApoI	RAATTY	4 cut(s)	53, 281, 314, 1132
AspLEI	GCGC	3 cut(s)	1260, 1294, 1413
AsuHPI	GGTGA	3 cut(s)	476, 802, 1484
BalI	TGGCCA	1 cut(s)	33
BbsI	GAAGAC	2 cut(s)	453, 674
Bbv12I	GWGCWC	2 cut(s)	307, 1680
BbvI	GCAGC	3 cut(s)	612, 887, 1021
BccI	CCATC	1 cut(s)	398
BceAI	ACGGC	1 cut(s)	467
BciT130I	CCWGG	3 cut(s)	100, 108, 833
BclI	TGATCA	1 cut(s)	1516
BcoDI	GTCTC	2 cut(s)	490, 1491
BfaI	CTAG	4 cut(s)	560, 891, 945, 1542
BfmI	CTRYAG	4 cut(s)	711, 999, 1569, 1667
BfrI	CTTAAG	1 cut(s)	319
BisI	GCNGC	3 cut(s)	626, 876, 1035
BlsI	GCNGC	3 cut(s)	627, 877, 1036
Bme1390I	CCNGG	3 cut(s)	100, 108, 833
BmiI	GGNNCC	2 cut(s)	472, 837
BmrFI	CCNGG	3 cut(s)	100, 108, 833
BmsI	GCATC	6 cut(s)	141, 631, 665, 985, 1324, 1386
BpiI	GAAGAC	2 cut(s)	453, 674
BpmI	CTGGAG	3 cut(s)	381, 1707, 1713
BsaBI	GATNNNNATC	1 cut(s)	978
BsaJI	CCNNGG	1 cut(s)	98
BsaWI	WCCGGW	1 cut(s)	49
Bse1I	ACTGG	3 cut(s)	704, 1043, 1593
Bse3DI	GCAATG	3 cut(s)	294, 685, 1094
Bse8I	GATNNNNATC	1 cut(s)	978
BseBI	CCWGG	3 cut(s)	100, 108, 833
BseDI	CCNNGG	1 cut(s)	98
BseGI	GGATG	6 cut(s)	10, 773, 1012, 1060, 1360, 1627
BseJI	GATNNNNATC	1 cut(s)	978
BseMI	GCAATG	3 cut(s)	294, 685, 1094
BseMII	CTCAG	5 cut(s)	512, 545, 629, 1110, 1341
BseNI	ACTGG	3 cut(s)	704, 1043, 1593
BseRI	GAGGAG	1 cut(s)	1528
BseXI	GCAGC	3 cut(s)	612, 887, 1021
BsgI	GTGCAG	4 cut(s)	749, 1020, 1144, 1569
BshFI	GGCC	2 cut(s)	33, 106
BsiHKAI	GWGCWC	2 cut(s)	307, 1680
BsiSI	CCGG	1 cut(s)	50
BsmAI	GTCTC	2 cut(s)	490, 1491
BsmBI	CGTCTC	1 cut(s)	490
BsnI	GGCC	2 cut(s)	33, 106
Bsp1286I	GDGCHC	2 cut(s)	307, 1680
Bsp143I	GATC	8 cut(s)	40, 121, 193, 579, 760, 1516, 1564, 1701
BspACI	CCGC	4 cut(s)	480, 817, 839, 1004
BspANI	GGCC	2 cut(s)	33, 106
BspCNI	CTCAG	5 cut(s)	511, 544, 628, 1111, 1342
BspLI	GGNNCC	2 cut(s)	472, 837
BspPI	GGATC	6 cut(s)	35, 116, 201, 574, 1559, 1709
BspTI	CTTAAG	1 cut(s)	319
BsrDI	GCAATG	3 cut(s)	294, 685, 1094
BsrI	ACTGG	3 cut(s)	704, 1043, 1593
BssECI	CCNNGG	1 cut(s)	98
BssMI	GATC	8 cut(s)	40, 121, 193, 579, 760, 1516, 1564, 1701
BssNAI	GTATAC	1 cut(s)	1550
Bst1107I	GTATAC	1 cut(s)	1550
Bst2UI	CCWGG	3 cut(s)	100, 108, 833
Bst4CI	ACNGT	3 cut(s)	452, 470, 1024
Bst6I	CTCTTC	1 cut(s)	602
BstAFI	CTTAAG	1 cut(s)	319
BstC8I	GCNNGC	2 cut(s)	1225, 1409
BstDEI	CTNAG	5 cut(s)	498, 531, 615, 1119, 1350
BstF5I	GGATG	6 cut(s)	10, 773, 1012, 1060, 1360, 1627
BstHHI	GCGC	3 cut(s)	1260, 1294, 1413
BstKTI	GATC	8 cut(s)	43, 124, 196, 582, 763, 1519, 1567, 1704
BstMAI	GTCTC	2 cut(s)	490, 1491
BstMBI	GATC	8 cut(s)	40, 121, 193, 579, 760, 1516, 1564, 1701
BstMWI	GCNNNNNNNGC	1 cut(s)	625
BstNI	CCWGG	3 cut(s)	100, 108, 833
BstNSI	RCATGY	2 cut(s)	16, 1663
BstSCI	CCNGG	3 cut(s)	98, 106, 831
BstSFI	CTRYAG	4 cut(s)	711, 999, 1569, 1667
BstV1I	GCAGC	3 cut(s)	612, 887, 1021
BstV2I	GAAGAC	2 cut(s)	453, 674
BstX2I	RGATCY	1 cut(s)	1701
BstYI	RGATCY	1 cut(s)	1701
BstZ17I	GTATAC	1 cut(s)	1550
BsuRI	GGCC	2 cut(s)	33, 106
BtsCI	GGATG	6 cut(s)	10, 773, 1012, 1060, 1360, 1627
BtsIMutI	CAGTG	3 cut(s)	457, 582, 1586
Cac8I	GCNNGC	2 cut(s)	1225, 1409
CfoI	GCGC	3 cut(s)	1260, 1294, 1413
CviAII	CATG	5 cut(s)	13, 59, 916, 1114, 1660
DdeI	CTNAG	5 cut(s)	498, 531, 615, 1119, 1350
DpnI	GATC	8 cut(s)	42, 123, 195, 581, 762, 1518, 1566, 1703
DpnII	GATC	8 cut(s)	40, 121, 193, 579, 760, 1516, 1564, 1701
DraI	TTTAAA	2 cut(s)	1167, 1467
EaeI	YGGCCR	1 cut(s)	31
Eam1104I	CTCTTC	1 cut(s)	602
EarI	CTCTTC	1 cut(s)	602
EciI	GGCGGA	1 cut(s)	828
Eco57I	CTGAAG	1 cut(s)	111
EcoRI	GAATTC	4 cut(s)	53, 281, 314, 1132
EcoRII	CCWGG	3 cut(s)	98, 106, 831
EcoT22I	ATGCAT	1 cut(s)	1401
Esp3I	CGTCTC	1 cut(s)	490
FaeI	CATG	5 cut(s)	16, 62, 919, 1117, 1663
FalI	AAGNNNNNCTT	4 cut(s)	1023, 1055, 1323, 1355
FatI	CATG	5 cut(s)	12, 58, 915, 1113, 1659
FauI	CCCGC	1 cut(s)	824
FauNDI	CATATG	1 cut(s)	541
FbaI	TGATCA	1 cut(s)	1516
FblI	GTMKAC	2 cut(s)	1187, 1549
Fnu4HI	GCNGC	3 cut(s)	626, 876, 1035
FokI	GGATG	6 cut(s)	17, 780, 1019, 1067, 1367, 1634
Fsp4HI	GCNGC	3 cut(s)	626, 876, 1035
FspBI	CTAG	4 cut(s)	560, 891, 945, 1542
GlaI	GCGC	3 cut(s)	1259, 1293, 1412
GluI	GCNGC	3 cut(s)	626, 876, 1035
GsuI	CTGGAG	3 cut(s)	381, 1707, 1713
HaeIII	GGCC	2 cut(s)	33, 106
HapII	CCGG	1 cut(s)	50
HhaI	GCGC	3 cut(s)	1260, 1294, 1413
Hin1II	CATG	5 cut(s)	16, 62, 919, 1117, 1663
Hin6I	GCGC	3 cut(s)	1258, 1292, 1411
HinP1I	GCGC	3 cut(s)	1258, 1292, 1411
HindIII	AAGCTT	1 cut(s)	1453
HinfI	GANTC	7 cut(s)	408, 670, 979, 1313, 1432, 1580, 1641
HpaII	CCGG	1 cut(s)	50
HphI	GGTGA	3 cut(s)	476, 802, 1484
Hpy166II	GTNNAC	2 cut(s)	1188, 1550
Hpy188III	TCNNGA	5 cut(s)	239, 308, 360, 983, 1686
Hpy8I	GTNNAC	2 cut(s)	1188, 1550
HpyAV	CCTTC	7 cut(s)	135, 875, 921, 929, 1073, 1208, 1521
HpyCH4III	ACNGT	3 cut(s)	452, 470, 1024
HpyF10VI	GCNNNNNNNGC	1 cut(s)	625
HpyF3I	CTNAG	5 cut(s)	498, 531, 615, 1119, 1350
Hsp92II	CATG	5 cut(s)	16, 62, 919, 1117, 1663
HspAI	GCGC	3 cut(s)	1258, 1292, 1411
Ksp22I	TGATCA	1 cut(s)	1516
Kzo9I	GATC	8 cut(s)	40, 121, 193, 579, 760, 1516, 1564, 1701
LmnI	GCTCC	2 cut(s)	1675, 1688
Lsp1109I	GCAGC	3 cut(s)	612, 887, 1021
LweI	GCATC	6 cut(s)	141, 631, 665, 985, 1324, 1386
MaeI	CTAG	4 cut(s)	560, 891, 945, 1542
MaeIII	GTNAC	5 cut(s)	464, 689, 706, 1015, 1045
MalI	GATC	8 cut(s)	42, 123, 195, 581, 762, 1518, 1566, 1703
MboI	GATC	8 cut(s)	40, 121, 193, 579, 760, 1516, 1564, 1701
MflI	RGATCY	1 cut(s)	1701
MhlI	GDGCHC	2 cut(s)	307, 1680
MlsI	TGGCCA	1 cut(s)	33
MluNI	TGGCCA	1 cut(s)	33
MlyI	GAGTC	4 cut(s)	417, 664, 1574, 1650
MmeI	TCCRAC	2 cut(s)	584, 1514
MnlI	CCTC	8 cut(s)	136, 358, 507, 979, 1345, 1362, 1549, 1665
Mox20I	TGGCCA	1 cut(s)	33
Mph1103I	ATGCAT	1 cut(s)	1401
MscI	TGGCCA	1 cut(s)	33
MseI	TTAA	6 cut(s)	228, 320, 1166, 1466, 1626, 1656
MslI	CAYNNNNRTG	1 cut(s)	63
Msp20I	TGGCCA	1 cut(s)	33
MspA1I	CMGCKG	1 cut(s)	619
MspCI	CTTAAG	1 cut(s)	319
MspI	CCGG	1 cut(s)	50
MspR9I	CCNGG	3 cut(s)	100, 108, 833
MvaI	CCWGG	3 cut(s)	100, 108, 833
MwoI	GCNNNNNNNGC	1 cut(s)	625
NdeI	CATATG	1 cut(s)	541
NdeII	GATC	8 cut(s)	40, 121, 193, 579, 760, 1516, 1564, 1701
NlaIII	CATG	5 cut(s)	16, 62, 919, 1117, 1663
NlaIV	GGNNCC	2 cut(s)	472, 837
NmuCI	GTSAC	3 cut(s)	464, 689, 1015
NsiI	ATGCAT	1 cut(s)	1401
NspI	RCATGY	2 cut(s)	16, 1663
PciI	ACATGT	2 cut(s)	12, 1659
PfeI	GAWTC	3 cut(s)	979, 1313, 1432
PkrI	GCNGC	3 cut(s)	627, 877, 1036
PleI	GAGTC	4 cut(s)	416, 664, 1574, 1649
PpsI	GAGTC	4 cut(s)	416, 664, 1574, 1649
PscI	ACATGT	2 cut(s)	12, 1659
PsiI	TTATAA	1 cut(s)	1176
Psp6I	CCWGG	3 cut(s)	98, 106, 831
PspGI	CCWGG	3 cut(s)	98, 106, 831
PspN4I	GGNNCC	2 cut(s)	472, 837
PsuI	RGATCY	1 cut(s)	1701
PvuII	CAGCTG	1 cut(s)	619
RseI	CAYNNNNRTG	1 cut(s)	63
SaqAI	TTAA	6 cut(s)	228, 320, 1166, 1466, 1626, 1656
SatI	GCNGC	3 cut(s)	626, 876, 1035
Sau3AI	GATC	8 cut(s)	40, 121, 193, 579, 760, 1516, 1564, 1701
SchI	GAGTC	4 cut(s)	417, 664, 1574, 1650
ScrFI	CCNGG	3 cut(s)	100, 108, 833
SduI	GDGCHC	2 cut(s)	307, 1680
SfaNI	GCATC	6 cut(s)	141, 631, 665, 985, 1324, 1386
SfcI	CTRYAG	4 cut(s)	711, 999, 1569, 1667
SmiI	ATTTAAAT	1 cut(s)	1467
SmiMI	CAYNNNNRTG	1 cut(s)	63
SmlI	CTYRAG	1 cut(s)	319
SmoI	CTYRAG	1 cut(s)	319
SsiI	CCGC	4 cut(s)	480, 817, 839, 1004
SspI	AATATT	1 cut(s)	1155
SspMI	CTAG	4 cut(s)	560, 891, 945, 1542
StyD4I	CCNGG	3 cut(s)	98, 106, 831
SwaI	ATTTAAAT	1 cut(s)	1467
TaaI	ACNGT	3 cut(s)	452, 470, 1024
TaqI	TCGA	4 cut(s)	137, 673, 1136, 1394
TfiI	GAWTC	3 cut(s)	979, 1313, 1432
Tru1I	TTAA	6 cut(s)	228, 320, 1166, 1466, 1626, 1656
Tru9I	TTAA	6 cut(s)	228, 320, 1166, 1466, 1626, 1656
TscAI	CASTG	3 cut(s)	457, 582, 1593
TseFI	GTSAC	3 cut(s)	464, 689, 1015
TseI	GCWGC	3 cut(s)	625, 875, 1034
Tsp45I	GTSAC	3 cut(s)	464, 689, 1015
TspDTI	ATGAA	7 cut(s)	123, 228, 528, 1023, 1145, 1305, 1445
TspGWI	ACGGA	3 cut(s)	127, 647, 1221
TspRI	CASTG	3 cut(s)	457, 582, 1593
Vha464I	CTTAAG	1 cut(s)	319
XapI	RAATTY	4 cut(s)	53, 281, 314, 1132
XceI	RCATGY	2 cut(s)	16, 1663
XmiI	GTMKAC	2 cut(s)	1187, 1549
XspI	CTAG	4 cut(s)	560, 891, 945, 1542
Zsp2I	ATGCAT	1 cut(s)	1401

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.