Rmu_sc0001912.1_g000016

Protein phosphatase 2C 57-like

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001912.1
Physical Location & Seq
Reverse (-)
47329 .. 47977
649 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001912.1_g000016.1.cds

Sequence Viewer

Length: 276 bp
atgcacaatattgacggttttgataaatggaaaggatcgatgctgaagaaaggagttgaagaaggaagatggacggagaaatttgtttctcgtggagaccttgttactgcatctccagacgtttatcaagcaagtctaggggcagactcagaatttctagtgttagcatctgatggtttatgggattacataaacagttcagatgcagtttcttttgtaaggaatcagcttcgacaacatggagatgtccaggtatatatggcctacacatcttaa

Protein Analysis

91

Amino Acids

10.22

Weight (kDa)

4.91

Isoelectric Point (pI)

49.3

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 43
AcsI RAATTY 2 cut(s) 80, 152
AcuI CTGAAG 1 cut(s) 65
AgsI TTSAA 1 cut(s) 59
AjnI CCWGG 1 cut(s) 249
AluBI AGCT 1 cut(s) 229
AluI AGCT 1 cut(s) 229
Alw26I GTCTC 1 cut(s) 90
AlwI GGATC 1 cut(s) 43
AoxI GGCC 1 cut(s) 261
ApoI RAATTY 2 cut(s) 80, 152
BauI CACGAG 1 cut(s) 90
BccI CCATC 2 cut(s) 63, 167
BciT130I CCWGG 1 cut(s) 251
BcoDI GTCTC 1 cut(s) 90
BfaI CTAG 2 cut(s) 137, 158
Bme1390I CCNGG 1 cut(s) 251
BmrFI CCNGG 1 cut(s) 251
BmsI GCATC 4 cut(s) 30, 119, 176, 193
BpmI CTGGAG 1 cut(s) 99
Bsa29I ATCGAT 1 cut(s) 38
BsaI GGTCTC 1 cut(s) 90
BsaXI ACNNNNNCTCC 4 cut(s) 87, 97, 117, 127
BseBI CCWGG 1 cut(s) 251
BseCI ATCGAT 1 cut(s) 38
BseMII CTCAG 1 cut(s) 162
BshFI GGCC 1 cut(s) 263
BshVI ATCGAT 1 cut(s) 38
BsmAI GTCTC 1 cut(s) 90
BsnI GGCC 1 cut(s) 263
Bso31I GGTCTC 1 cut(s) 90
Bsp143I GATC 1 cut(s) 35
BspANI GGCC 1 cut(s) 263
BspCNI CTCAG 1 cut(s) 161
BspDI ATCGAT 1 cut(s) 38
BspPI GGATC 1 cut(s) 43
BspTNI GGTCTC 1 cut(s) 90
BssMI GATC 1 cut(s) 35
BssSI CACGAG 1 cut(s) 90
Bst2BI CACGAG 1 cut(s) 90
Bst2UI CCWGG 1 cut(s) 251
Bst4CI ACNGT 2 cut(s) 17, 197
BstDEI CTNAG 1 cut(s) 148
BstKTI GATC 1 cut(s) 38
BstMAI GTCTC 1 cut(s) 90
BstMBI GATC 1 cut(s) 35
BstNI CCWGG 1 cut(s) 251
BstSCI CCNGG 1 cut(s) 249
Bsu15I ATCGAT 1 cut(s) 38
BsuRI GGCC 1 cut(s) 263
BsuTUI ATCGAT 1 cut(s) 38
ClaI ATCGAT 1 cut(s) 38
CviAII CATG 1 cut(s) 239
CviJI RGCY 2 cut(s) 229, 263
CviKI_1 RGCY 2 cut(s) 229, 263
DdeI CTNAG 1 cut(s) 148
DpnI GATC 1 cut(s) 37
DpnII GATC 1 cut(s) 35
Eco31I GGTCTC 1 cut(s) 90
Eco57I CTGAAG 1 cut(s) 65
EcoRII CCWGG 1 cut(s) 249
FaeI CATG 1 cut(s) 242
FaiI YATR 6 cut(s) 181, 191, 240, 256, 258, 260
FatI CATG 1 cut(s) 238
FspBI CTAG 2 cut(s) 137, 158
GsuI CTGGAG 1 cut(s) 99
HaeIII GGCC 1 cut(s) 263
Hin1II CATG 1 cut(s) 242
HinfI GANTC 2 cut(s) 146, 223
Hpy188I TCNGA 3 cut(s) 151, 172, 202
Hpy188III TCNNGA 1 cut(s) 116
HpyAV CCTTC 1 cut(s) 56
HpyCH4III ACNGT 2 cut(s) 17, 197
HpyCH4IV ACGT 1 cut(s) 120
HpyCH4V TGCA 3 cut(s) 4, 110, 206
HpyF3I CTNAG 1 cut(s) 148
HpySE526I ACGT 1 cut(s) 120
Hsp92II CATG 1 cut(s) 242
Kzo9I GATC 1 cut(s) 35
LpnPI CCDG 3 cut(s) 129, 236, 263
LweI GCATC 4 cut(s) 30, 119, 176, 193
MaeI CTAG 2 cut(s) 137, 158
MaeII ACGT 1 cut(s) 120
MaeIII GTNAC 1 cut(s) 103
MalI GATC 1 cut(s) 37
MboI GATC 1 cut(s) 35
MboII GAAGA 3 cut(s) 58, 71, 78
MluCI AATT 2 cut(s) 80, 152
MlyI GAGTC 1 cut(s) 140
MseI TTAA 1 cut(s) 274
MslI CAYNNNNRTG 1 cut(s) 243
MspR9I CCNGG 1 cut(s) 251
MvaI CCWGG 1 cut(s) 251
NdeII GATC 1 cut(s) 35
NlaIII CATG 1 cut(s) 242
PfeI GAWTC 1 cut(s) 223
PleI GAGTC 1 cut(s) 140
PpsI GAGTC 1 cut(s) 140
Psp6I CCWGG 1 cut(s) 249
PspGI CCWGG 1 cut(s) 249
RseI CAYNNNNRTG 1 cut(s) 243
SaqAI TTAA 1 cut(s) 274
Sau3AI GATC 1 cut(s) 35
SchI GAGTC 1 cut(s) 140
ScrFI CCNGG 1 cut(s) 251
SetI ASST 4 cut(s) 102, 123, 231, 255
SfaNI GCATC 4 cut(s) 30, 119, 176, 193
SmiMI CAYNNNNRTG 1 cut(s) 243
Sse9I AATT 2 cut(s) 80, 152
SspI AATATT 1 cut(s) 10
SspMI CTAG 2 cut(s) 137, 158
StyD4I CCNGG 1 cut(s) 249
TaaI ACNGT 2 cut(s) 17, 197
TaiI ACGT 1 cut(s) 123
TaqI TCGA 2 cut(s) 38, 232
TasI AATT 2 cut(s) 80, 152
TfiI GAWTC 1 cut(s) 223
Tru1I TTAA 1 cut(s) 274
Tru9I TTAA 1 cut(s) 274
TspGWI ACGGA 1 cut(s) 89
XapI RAATTY 2 cut(s) 80, 152
XspI CTAG 2 cut(s) 137, 158
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.